Table 1. Plasmids designed and used in this study.
| Plasmid | Description | Reference or source |
|---|---|---|
| pTetR-VP16 | Constitutive transactivator tTA expression vector | Clontech, CA |
| prTetR-VP16 | Constitutive transactivator rtTA expression vector | Clontech, CA |
| pTRE2 | A Tc-response plasmid containing 7xtetO sequence and CMV minimal promoter | Clontech, CA |
| pTRIPz | Entiviral vector containing 6xtetO sequence | Open Biosystems |
| pGAVPO | Constitutive light-switchable transactivation factor GAVPO expression vector. | (26) |
| pU5-Gluc | A reporter vector for LigthOn system containing 5xUASG and E1b minimal promoter driven expression of Gluc. | (26) |
| pU5-Fluc | A reporter vector for LigthOn system containing 5xUASG and E1b minimal promoter driven expression of Fluc. | (26) |
| pU5-hrGFP | A reporter vector for LigthOn system containing 5xUASG and E1b minimal promoter driven expression of hrGFP. | (26) |
| pCDNA3.1-hrGFP | Constitutive hrGFP expression vector. | (26) |
| pU5-mCherry | A reporter vector for LigthOn system containing 5xUASG and E1b minimal promoter driven expression of mCherry. | (26) |
| pU3-Gluc | A reporter vector for LigthOn system containing 3xUASG and E1b minimal promoter. | (40) |
| pU2-Gluc | A reporter vector for LigthOn system containing 2xUASG and E1b minimal promoter. | (40) |
| pU1-Gluc | A reporter vector for LigthOn system containing 1xUASG and E1b minimal promoter. | (40) |
| pTetR-KRAB | Constitutive transsilencer TetR-KRAB (tTS) expression vector. TetR was PCR-amplified from pTetR-VP16 using oligonucleotides TetR/rTetR-F (5′- cccgaattcaccatgtctagattagataaa -3′) and TetR/rTetR-R (5′-cactgacactgctagggacccactttcacattt-3′), and then was fused to KRAB commercially synthesized by Shanghai generay Biotech Co.,Ltd using overlap PCR. The fused fragment was restricted with EcoRI/SalI and cloned into the corresponding sites (EcoRI/SalI) of pTetR-VP16. | This work |
| pT6U1-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 6xTetO and 1xUASG adjacent to E1b minimal promoter. 6xTetO was PCR-amplified from pTRIPz using oligonucleotides 6xTetO-F (5′-gccctcgaggtccgaggttctagacgag-3′) and 6xTetO-R(5′-gggagcgctcaccatgtctagactggacaagag-3′), restricted with XhoI/Eco47III and cloned into the corresponding sites (XhoI/Eco47III) of pU1-Gluc. | This work |
| pT6U2-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 6xTetO and 2xUASG adjacent to E1b minimal promoter. Similar to pT6U1-Gluc, 6xTetO was inserted into the XhoI/Eco47III sites of pU2-Gluc. | This work |
| pT6U3-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 6xTetO and 3xUASG adjacent to E1b minimal promoter. Similar to pT6U1-Gluc, 6xTetO was inserted into the XhoI/Eco47III sites of pU3-Gluc. | This work |
| pT6U5-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 6xTetO and 5xUASG adjacent to E1b minimal promoter. 5xUASG was cut off from pU5-Gluc by KpnI/NheI digestion and inserted into the corresponding sites (EcoRI/SalI) of pT6U3-Gluc. | This work |
| pU5T1-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 1xTetO and 5xUASG adjacent to E1b minimal promoter. The oligonucleotides 1xTet-F (5′-ctagcggctcgagtttactccctatcagtgatagagaacgtatgagct-3′) and 1xTet-R(5′-catacgttctctatcactgatagggagtaaactcgagccg-3′) were annealed, phosphorylated and then inserted into the NheI/SacI sites of pU5-Gluc. | This work |
| pU5T2-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 2xTetO and 5xUASG adjacent to E1b minimal promoter. The oligonucleotides 2xTet-F (5′- ctagcggctcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgatgtcgaccgagct-3′) and 2xTet-R (5′- cggtcgacatcgttctctatcactgatagggagtaaactcgacatacgttctctatcactgatagggagtaaactcgagccg-3′) were annealed, phosphatized and then inserted into the NheI/SacI sites of pU5-Gluc. | This work |
| pU5T4-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 4xTetO and 5xUASG adjacent to E1b minimal promoter. 2xTetO was cut off from pU5T2-Gluc by XhoI/SacI double digestion and inserted into the SalI/SacI sites of pU5T2-Gluc to generate pU5T4-Gluc. | This work |
| pU5T6-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 6xTetO and 5xUASG adjacent to E1b minimal promoter. 2xTetO was cut off from pU5T2-Gluc by XhoI/SacI double digestion and inserted into the SalI/SacI sites of pU5T4-Gluc to generate pU5T6-Gluc. | This work |
| p(TU)1-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 1xTetO and 1xUASG (1xTU) adjacent to E1b minimal promoter. The oligonucleotide(5′-ggtaccctgagctggatgagccgcgctcgagtttactccctatcagtgatagagaacgtatgtccggagtactgtcctccggtcgactatcgtagtccagcgctacgagctc-3′) was commercially synthesized by Shanghai generay Biotech Co.,Ltd and was inserted into the KpnI/SacI sites of pU5T2-Gluc. | This work |
| p(TU)2-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 2xTU adjacent to E1b minimal promoter. 1xTU was cut off from p(TU)1-Gluc by XhoI/SacI double digestion and inserted into the SalI/SacI sites of p(TU)1-Gluc to generate p(TU)2-Gluc. | This work |
| p(TU)3-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 3xTU adjacent to E1b minimal promoter. 1xTU was cut off from p(TU)1-Gluc by XhoI/SacI double digestion and inserted into the SalI/SacI sites of p(TU)2-Gluc to generate p(TU)3-Gluc. | This work |
| p(TU)4-Gluc | Tetracycline and blue light-responsive Gluc expression vector containing 3xTU adjacent to E1b minimal promoter. 1xTU was cut off from p(TU)1-Gluc by XhoI/SacI double digestion and inserted into the SalI/SacI sites of p(TU)3-Gluc to generate p(TU)4-Gluc. | This work |
| pTRE2-Gluc | Gluc gene amplified from pU5-Gluc was cloned into BamHI/HindIII sites of pTRE2. | This work |
| pT6U3-DTA | Tetracycline and blue light-responsive Gluc expression vector containing 6xTetO and 3xUASG adjacent to E1b minimal promoter, the reporter gene is DTA. DTA gene was commercially synthesized by Shanghai generay Biotech Co.,Ltd and cloned into HindIII/BamHI sites of pT6U3-Gluc to generate pT6U3-DTA. | This work |
| pU5-DTA | A reporter vector for LigthOn system containing 5xUASG and E1b minimal promoter driven expression of DTA. Gluc gene in pU5-Gluc was replaced by DTA by HindIII/ BamHI digestion. | This work |
| pT6U3-Fluc | Tetracycline and blue light-responsive Gluc expression vector containing 6xTetO and 3xUASG adjacent to E1b minimal promoter, the reporter gene is Fluc. Fluc gene was PCR-amplified from pU5-Fluc using oligonucleotides Fluc-F (5′- cccaagcttcaccatggaagacgccaaaaacat-3′) and Fluc-R (5′- cccggatccttacacggcgatctttccgc-3′), restricted with HindIII/BamHI and cloned into the corresponding sites (HindIII/BamHI) of pT6U3-Gluc. | This work |
| pT6U3-mCherry | Tetracycline and blue light-responsive Gluc expression vector containing 6xTetO and 3xUASG adjacent to E1b minimal promoter. Gluc gene of pT6U3-Gluc was replaced by mCherry by HindIII/BamHI digestion. | This work |
TetR, E.coli Tn10-derived repressor of the TET resistance gene; VP16, Herpes simplexvirus-derived transactivation domain; rTetR, amino acid exchanges in the TetR, reversing the response of the presence of the allosteric effector Dox; GAVPO, a light-switchable transcription factor consisting of DNA binding domain of Gal4, a light-oxygen-voltage (LOV) domain–containing protein VIVID and p65 activation domain from NF-κB. GLuc, Gaussia princeps luciferase; Fluc, Firefly luciferase. mCherry, a red fluorescent protein; KRAB, Krueppel-associated box domain of the human kox-1 gene; tTA, TET-dependent transactivator; rtTA, TET-dependent transactivator shows reverse response to the presence of Dox relative to tTA; UASG, upstream active sequence, an enhancer to which GAL4 specifically binds to activate gene transcription. TetO, operator sequence can be recognized and bond by tTA and rtTA to activate gene transcription; DTA, a segment of the diphtheria toxin (tox), inhibits protein synthesis in cells; hrGFP, humanized Renilla reniformis green fluorescent protein.