Table 1.
Diptera-specific PCR primers designed in this study
| Specifity | Genetic marker | Primer | Sequences of primer (5′–3′) | Amplicon size |
|---|---|---|---|---|
| Diptera | COI | H15CuliCOIFw | AGCCATTTAATCGCGACAA | 750 |
| H15CuliCOIRv | GGATGTCCAAAAAATCAAAATAAATGTT |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.