Table 1.
Bacterial strains, plasmids and primers used in this study.
| Strains, plasmids, or primers | Genotype, relevant characteristics, or sequences | References or source |
|---|---|---|
| STRAINS | ||
| P. protegens | ||
| LK099 | Wild-type strain Pf-5 | Howell and Stipanovic, 1979 |
| LK298 | Pf-5 derivative strain contains pltR with modifications in 35 types of rare codons in the chromosome | This study |
| LK361 | Pf-5 derivative strain contains pltR with modifications in six types of rare codons in the chromosome. The modified codons are CUA, GUU, AUA, CUU, UAU, and GUA | This study |
| LK362 | Pf-5 derivative strain contains pltR with modifications in six types of rare codons in the chromosome. The modified codons are ACU, GGU, GGA, GCU, CCA, and CCU | This study |
| LK363 | Pf-5 derivative strain contains pltR with modifications in six types of rare codons in the chromosome. The modified codons are UCU, UGU, CGA, UUG, UUU, and GCA | This study |
| LK364 | Pf-5 derivative strain contains pltR with modifications in five types of rare codons in the chromosome. The modified codons are UUA, AUU, AGU, AGG, and AGA | This study |
| LK365 | Pf-5 derivative strain contains pltR with modifications in the AGA rare codon in the chromosome | This study |
| E. coli | ||
| Top10 | F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (Smr) endA1 nupG | Invitrogen |
| S17-1 | recA pro hsdR−M+ RP4 2-Tc::Mu-Km::Tn7 Smr Tpr | Simon et al., 1983 |
| PLASMIDS | ||
| pEX18Km | Gene replacement vector with MCS from pUC18, sacB+ Kmr | Hoang et al., 1998 |
| pEX18km-pltR-MCod3 | pEX18Km with a 1.6 Kb XbaI fragment synthesized from IDT, containing pltR of Pf-5 with modifications in 35 types of codons | This study |
| pEX18Tc | Gene replacement vector with MCS from pUC18, sacB+ Tcr | Hoang et al., 1998 |
| pEX18Tc-pltR-Mcod4-1 | pEX18Tc with a 1.6 Kb XbaI fragment synthesized from IDT, containing pltR of Pf-5 with modifications in six types of codons (CUA, GUU, AUA, CUU, UAU and GUA). | This study |
| pEX18Tc-pltR-Mcod4-2 | pEX18Tc with a 1.6 Kb XbaI fragment synthesized from IDT, containing pltR of Pf-5 with modifications in six types of codons (ACU, GGU, GGA, GCU, CCA, and CCU). | This study |
| pEX18Tc-pltR-Mcod4-3 | pEX18Tc with a 1.6 Kb XbaI fragment synthesized from IDT, containing pltR of Pf-5 with modifications in six types of codons (UCU, UGU, CGA, UUG, UUU and GCA). | This study |
| pEX18Tc-pltR-Mcod4-4 | pEX18Tc with a 1.6 Kb XbaI fragment synthesized from IDT, containing pltR of Pf-5 with modifications in five types of codons (UUA, AUU, AGU, AGG and AGA). | This study |
| pEX18Tc-pltR-Mcod5 | pEX18Tc with a 1.6 Kb XbaI fragment synthesized from IDT, containing pltR of Pf-5 with modifications in the AGA rare codons. | This study |
| pPROBE'-gfp(tagless) | pBBR1, containing promoterless gfp, Kmr | Miller et al., 2000 |
| pprnA-gfp (AGA) | pPROBE'-gfp(tagless) with a 1.3 Kb HindIII-SalI PCR fragment amplified from genomic DNA of Pf-5, containing a prnA::gfp (AGA) transcriptional fusion | This study |
| pprnA-gfp (CGC) | pprnA-gfp withthe AGA codons of gfp were substituted with synonymous common codons, containing a prnA::gfp(CGC) transcriptional fusion | This study |
| ppltL-gfp | pPROBE'-gfp(tagless) with a 0.1 Kb EcoRI-KpnI PCR fragment amplified from genomic DNA of Pf-5, containing a pltL::gfp transcriptional fusion | This study |
| pME6010 | pACYC177-pVS1 shuttle vector, Tcr | Heeb et al., 2000 |
| P6010-Arg | pME6010 with a 0.6 Kb SalI-EcoRI PCR fragment amplified from the genomic DNA of Pf-5, containing a constitutively expressed PFL_3991 | This study |
| Primers (5′–3′) | ||
| prnA-f2 | TATAAGCTTTGCCGCCATGGCCAACGCC | |
| prnA-r1 | CAAAGATGCAGTAGTAGTTGCCG | |
| gfp-plt-f3 | ATAGAATTCGGGGCTGTTTTGCCTTTGC | |
| gfp-plt-r1 | ATGGTACCATAGACGTACGCTCCTGC | |
| 3989-91-DnR-SalI | ATAGTCGACTTGAGTGGTGTTGGCGGGCA | |
| 3991-R2 | ATAGAATTCTTGTGCCAAAGCTGCCT | |