TABLE 2.
Oligonucleotides used in this study for cloning, sequencing, and segregation analysis of genes of interest
| Name | Sequence (5′→3′)b | Description |
|---|---|---|
| LT 102Fa | AGTCGGCAAATAACCCTCGG | Forward sequencing primer for the pSyn_1/D-TOPO Life Technologies vector |
| LT 102Ra | CGTTTTATTTGATGCCTGGC | Reverse sequencing primer for the pSyn_1/D-TOPO Life Technologies vector |
| NS1-Fa | CGTCGAAGATGGAAAAGCTC | Forward primer for segregation analysis of the neutral site 1 locus |
| NS1-Ra | ATTGACCCGGTAGGGATTTC | Reverse primer for segregation analysis of the neutral site 1 locus |
| TOPO-1901F2 | caccATGCAGATTGGCATTATTGCTCCCAGCTC | Forward primer for cloning 1901 |
| TOPO-1901R2 | ctaTTATTTCAACAATTCTTTGAGGGCGATCGCGTAGTC | Reverse primer for cloning 1901 |
| TOPO-1902F | caccATGCGGATTGCGATCGCAACAG | Forward primer for cloning 1902 |
| TOPO-1902R | ttaCTACGCGAACGAAGAAGTTAAACGATTTACC | Reverse primer for cloning 1902 |
| TOPO-1904F | caccATGTCTATTTCATCGCCTACACCCAGTCC | Forward primer for cloning 1904 |
| TOPO-1904R | ttaCTAGCGAATTGTCTTGAGTGCATCACTACTACG | Reverse primer for cloning 1904 |
| TOPO-1905F2 | caccATGGTTGCTATTCCTTCGAACC | Forward primer for cloning 1905 and segregation analysis of the 1905 locus |
| TOPO-1905R2 | ctaTTAGTTCAAAGCATCTTGTTGACG | Reverse primer for cloning 1905 and segregation analysis of the 1905 locus |
| 1901genomeF | TTCAGCTGTGTAATTGTGGC | Forward primer for segregation analysis of the 1901 locus |
| 1901genomeR | CTCGCAAAGGTCTAAATTGC | Reverse primer for segregation analysis of the 1901 locus |
| 1902genomeF | GAGATAGGCTACGTTGATGC | Forward primer for segregation analysis of the 1902 locus |
| 1902genomeR | TAATGACACCCGCAAAGTTC | Reverse primer for segregation analysis of the 1902 locus |
| 1903genomeFa | TGATGCACTCAAGACAATTCG | Forward primer for segregation analysis of the 1903 locus |
| 1903genomeRa | ATGCAGTTCTGCACCTCCTC | Reverse primer for segregation analysis of the 1903 locus |
| 1904genomeF | ACGAGAATTCCTTTGCACTG | Forward primer for segregation analysis of the 1904 locus |
| 1904genomeR | TCAGTTAACGACTGTTGCTG | Reverse primer for segregation analysis of the 1904 locus |
| sp1901seq | TTTAGATAACGCCAAGCGAG | Sequencing primer for 1901 |
| sp1901seqR | GTGATACAGATGGCAGAGCC | Sequencing primer for 1901 |
| TOPO-2292F | caccATGATGCCATCTCCAGCCGGCTC | Forward primer for cloning 2292 |
| TOPO-2292R | tcattaTCAGGCGAGCGGAGAACTAGAGGTG | Reverse primer for cloning 2292 |
| TOPO-2293F | caccATGACTGTGCGATCGCGCTTTC | Forward primer for cloning 2293 |
| TOPO-2293R | ttaCTACTGTGCTGCTGGAGCTGACAG | Reverse primer for cloning 2293 |
| TOPO-2294F-2 | caccATGGCCGATCCCATTCG | Forward primer for segregation analysis of the 2294 locus |
| TOPO-2294R-2 | ttaTCAGACCTTGACCGGACG | Reverse primer for segregation analysis of the 2294 locus |
| TOPO-2295F-2 | caccATGCGGCGACTCATCGA | Forward primer for segregation analysis of the 2295 locus |
| TOPO-2295R-2 | ttaCTACAACCTTGGATTGCTAGCC | Reverse primer for segregation analysis of the 2295 locus |
| 2292genomeF | TTTAACTGTGCGGCAGTCCC | Forward primer for segregation analysis of the 2292 locus |
| 2292genomeR | ATCGGTTCTCGGTAGCGTTG | Reverse primer for segregation analysis of the 2292 locus |
| 2293genomeF | CTACCCACCTCTAGTTCTCC | Forward primer for segregation analysis of the 2293 locus |
| 2293genomeR | CTCCGGAACCAATGAAGATG | Reverse primer for segregation analysis of the 2293 locus |
| 2292seqF | TTGGTCTCGGACTACTCTGG | Sequencing primer for 2292 |
| TOPO-1342F | caccATGACCCGTAAGCGCGCC | Forward primer for cloning 1342 |
| TOPO-1342R | ttaTCACTCGAAGTAGTCGAAGGCC | Reverse primer for cloning 1342 |
| TOPO-2027F | caccGTGCCCAAGCTCTCTTTGATCATC | Forward primer for cloning 2027 |
| TOPO-2027R | ttaCTAAGCCAATCCTATGAGTTTACGGCG | Reverse primer for cloning 2027 |
| 1342genomeF | CCTGAAGGTTTGAGGAAGAG | Forward primer for segregation analysis of the 1342 locus |
| 1342genomeR | AGATTGGAAGTTGCTATCCAG | Reverse primer for segregation analysis of the 1342 locus |
| 2027genomeF | ACCTCTACTACATTGAGAACTGG | Forward primer for segregation analysis of the 2027 locus |
| 2027genomeR | AGATAGGGCAACAAACTGAG | Reverse primer for segregation analysis of the 2027 locus |
| TOPO-2098F | caccATGCAGATCCGCCACACCGC | Forward primer for segregation analysis of the 2098 locus |
| TOPO-2098R | ttaTCATATGAATACCTCCGCTTCCAAGAG | Reverse primer for segregation analysis of the 2098 locus |
| TOPO-2099F | caccATGAAGGTTTTACTGACAGGGGCTG | Forward primer for segregation analysis of the 2099 locus |
| TOPO-2099R | ttaTCATTGGTTCTTTGCAACTTGCGTC | Reverse primer for segregation analysis of the 2099 locus |
| TOPO-2100F | caccATGAAGATTTTGATTACGGGTGGTGCTG | Forward primer for segregation analysis of the 2100 locus |
| TOPO-2100R | ttaTCATACTGTGGTTTCCTGCTCCTGTG | Reverse primer for segregation analysis of the 2100 locus |
| TOPO-2101F | caccATGACCGAGGCACGGCGC | Forward primer for segregation analysis of the 2101 locus |
| TOPO-2101R | ttaTTAGAGAGGATTGTGCAAGAGGTCCAG | Reverse primer for segregation analysis of the 2101 locus |
| TOPO-0058F | caccATGCCAACTGAGTTACGAGCAACG | Forward primer for segregation analysis of the 0058 locus |
| TOPO-0058R | ttaTCATAATCCCGAGAGAAACGGTAAAGC | Reverse primer for segregation analysis of the 0058 locus |
| TOPO-0579F | caccATGCGCATCGCTCTCTTTACCG | Forward primer for segregation analysis of the 0579 locus |
| TOPO-0579R | ttaTCAGGCCGCTAAGGGTAAGC | Reverse primer for segregation analysis of the 0579 locus |
| TOPO-0948F | caccATGAAACCTCGATTCCGCTGG | Forward primer for segregation analysis of the 0948 locus |
| TOPO-0948R | ttaTTAGCCCTTCACTGCTCCGG | Reverse primer for segregation analysis of the 0948 locus |
| TOPO-0949F | caccATGACTCATCCGCCTCGTTGGC | Forward primer for segregation analysis of the 0949 locus |
| TOPO-0949R | ttaTCACAGTCCTCCCGACGGG | Reverse primer for segregation analysis of the 0949 locus |
| TOPO-0950F | caccATGCCGTTCTTGCGTTGTGG | Forward primer for segregation analysis of the 0950 locus |
| TOPO-0950R | ttaTCATGAGGCTGTTGCTCCTTGC | Reverse primer for segregation analysis of the 0950 locus |
| TOPO-0466F | caccATGACAAGGCCAATCAGCAGGC | Forward primer for segregation analysis of the 0466 locus |
| TOPO-0466R | ttaCTAGGAACGCTGCGGCACC | Reverse primer for segregation analysis of the 0466 locus |
| TOPO-0973F | caccTTGGCTGCTGGCGTCGC | Forward primer for segregation analysis of the 0973 locus |
| TOPO-0973R | ttaTTAGCGACCGATCCCGATGTAGC | Reverse primer for segregation analysis of the 0973 locus |
| TOPO-2151F | caccATGCAATTAAAACAACTGCGAAAACTTGCTCC | Forward primer for segregation analysis of the 2151 locus |
| TOPO-2151R | ttaTCAGCGGCTATTTGCCAAGGGATG | Reverse primer for segregation analysis of the 2151 locus |
| TOPO-1398F | caccATGCGTTTCCCCAACTTTCTACAGC | Forward primer for segregation analysis of the 1398 locus |
| TOPO-1398R | ttaTTAACCATTGTTGTAGCGCGTTAAAAGCG | Reverse primer for segregation analysis of the 1398 locus |
| TOPO-0220F | caccATGACTCAAATTGTTTCCGTACATTCGTTTCG | Forward primer for segregation analysis of the 0220 locus |
| TOPO-0220R | ttaCTAGTCACTGATCAAAGCATGCGCTAACT | Reverse primer for segregation analysis of the 0220 locus |
| TOPO-0133F | caccGTGCAGGAACTGCAAATGGCG | Forward primer for segregation analysis of the 0133 locus |
| TOPO-0133R | ttaCTATACGCAAGCGAGTACCTCACTCC | Reverse primer for segregation analysis of the 0133 locus |
| TOPO-0471F | caccGTGCGTCTCTCTGCTGGATTCCG | Forward primer for segregation analysis of the 0471 locus |
| TOPO-0471R | ttaTTATCCCTTCACACCACTGGCAGC | Reverse primer for segregation analysis of the 0471 locus |
| TOPO-1307F | caccATGAGTAGTCTCCTCGCTTCGACTG | Forward primer for segregation analysis of the 1307 locus |
| TOPO-1307R | ttaTTAGTCTTGCTGGCTGGCAAACTG | Reverse primer for segregation analysis of the 1307 locus |
| TOPO-0320F | caccGTGGCAGGGGCAACCATTCTG | Forward primer for segregation analysis of the 0320 locus |
| TOPO-0320R | ttaTCACGAGGGGCGATCGCA | Reverse primer for segregation analysis of the 0320 locus |
| TOPO-1608F | caccATGCTGGTTCCGGTCATCCTC | Forward primer for segregation analysis of the 1608 locus |
| TOPO-1608R | ttaTCAGCTACGACCGTAGTGGTCTTC | Reverse primer for segregation analysis of the 1608 locus |
| TOPO-2287F | caccATGAACCTGTCTCCGATCCGCC | Forward primer for segregation analysis of the 2287 locus |
| TOPO-2287R | ttaCTAAGGAGAGAACGACGGTTTTTTCCCG | Reverse primer for segregation analysis of the 2287 locus |
| TOPO-2290F | caccATGGTTCGAATTCTGGCAGTGATTCC | Forward primer for segregation analysis of the 2290 locus |
| TOPO-2290R | ctaTTAGCGTTGACTGGCCCATGCG | Reverse primer for segregation analysis of the 2290 locus |
| TOPO-0281F2 | caccATGACAGCCCCGGCTGCGCCTAC | Forward primer for segregation analysis of the 0281 locus |
| TOPO-0281R2 | tcattaTCAGGGAAGAGAACGGCGCGATCGCTG | Reverse primer for segregation analysis of the 0281 locus |
| TOPO-2025F | caccATGAGAGTTGCGATCGTTCACTATTGG | Forward primer for segregation analysis of the 2025 locus |
| TOPO-2025R | ttaCTAGAGCACCGACGTGAGGAAGC | Reverse primer for segregation analysis of the 2025 locus |
| TOPO-2028F | caccGTGGGCAATCTGTTAGTCAATTTGGCAATGG | Forward primer for segregation analysis of the 2028 locus |
| TOPO-2028R | tcattaCTAAAGAAATTTTTCGAGCACTTGGCAAGTTTCTTTACC | Reverse primer for segregation analysis of the 2028 locus |
| TOPO-0134F | caccTTGCGTATAGGGTCGATCCTGCG | Forward primer for segregation analysis of the 0134 locus |
| TOPO-0134R | ttaTCAGGCGCTTTGGGCCCG | Reverse primer for segregation analysis of the 0134 locus |
| TOPO-0357F | caccATGACTGTCTGGCAAACTCTGACTTTTGC | Forward primer for segregation analysis of the 0357 locus |
| TOPO-0357R | tcattaCTACATTTTTTCGTCTGAATGCTCGGCTTCTG | Reverse primer for segregation analysis of the 0357 locus |
| TOPO-0463F | caccATGACCGTCAAAGTACTGTTCGTCTGT | Forward primer for segregation analysis of the 0463 locus |
| TOPO-0463R | ttaTTAGCGGTGAGTTTTAATCAGTCCCTCTT | Reverse primer for segregation analysis of the 0463 locus |
| TOPO-2150F | caccATGACCAATACTCTCGGAATTGCTGCG | Forward primer for segregation analysis of the 2150 locus |
| TOPO-2150R | ttaTTATAGTCCAGCAAACTCGAATGGCTTGG | Reverse primer for segregation analysis of the 2150 locus |
| TOPO-1761F | caccGTGATCGGGAACAAGTGCAAATGTTG | Forward primer2 for segregation analysis of the 1761 locus |
| TOPO-1761R | ttaTCAGCCCCCCGCACGTG | Reverse primer for segregation analysis of the 1761 locus |
| TOPO-2148F | caccATGACGCTAGCCGTTCGTATTGAGC | Forward primer for segregation analysis of the 2148 locus |
| TOPO-2148R | ttaCTAACGTTGCATGGCGCGCTTTTTC | Reverse primer for segregation analysis of the 2148 locus |
| TOPO-2149F | caccATGACTACCACGCTACCGAAGTCTG | Forward primer for segregation analysis of the 2149 locus |
| TOPO-2149R | ttaCTAGCTTAGCGATCGCTTGAGGGC | Reverse primer for segregation analysis of the 2149 locus |
a
Originally published in the work of Simkovsky et al. (21).
b
Lowercase letters in the sequence indicate additional sequence that does not match the target genome or plasmid, such as the TOPO cloning tag (5′-cacc-3′) and additional stop codons.