Table 1. Sequence of mature miR-125b primer used.
| Name | Chromosomal location | Pre-miRNA length | Sequence (mature miRNA) |
|---|---|---|---|
| miR-125b | Chromosome 11 | 88 | 5'UCCCUGAGACCCUAACUUGUGA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.