Table 3.
Strains and plasmids used in this study.
| Strain or plasmid | Genotype | Reference |
|---|---|---|
| Streptococcus pneumoniae | ||
| Wild type | TIGR4 | Aaberge et al., 1995 |
| HPr S46D | ptsH 136TCA → 136GAC | This study |
| HPr S46A + pG+host9-HPr | ptsH 136TCA → 136GCT | This study |
| HPr H15A | ptsH 43CAC → 43GCG | This study |
| HPr H15A/S46A + pG+host9-HPr | ptsH 43CAC → 43GCG and 136TCA → 136GCT | This study |
| HPr S46A ΔpstI | ptsH 136TCA → 136GCT pstI::spec | This study |
| ΔccpA | ccpA::cat | Laboratory strain |
| ΔSP_0058 | SP_0058::spec | This study |
| ΔlacR-2 | lacR-2::spec | This study |
| ΔlacR-2 complemented in trans | lacR-2::spec, with lacR-2 promoter and coding region cloned into the SP_1773 locus | This study |
| ΔgalR | galR::spec | This study |
| ΔccpAΔSP_0058 | ccpA::cat, SP_0058::spec | This study |
| ΔccpAΔlacR-2 | ccpA::cat, lacR-2::spec | This study |
| PlacA operator mutant | Mutation of predicted LacR-2 operator preceeding the tagatose 6-phosphate operon promoter, TGTTACATTTACATATTTAT→TGTTTGTTTTACATATTTAT | This study |
| Escherichia coli | ||
| TG1 | K-12 supE thi-1 Δ(lac-proAB) Δ(mcrB-hsdSM)5, (rK−mK−) | Laboratory strain |
| PSP_0645 – lacZ | MG1655 Δ (lacI-promoter of lacZ), replaced with SP_0645 promoter region, kanR | This study |
| PSP_0916 – lacZ | MG1655 Δ (lacI-promoter of lacZ), replaced with SP_0916 promoter region, kanR | This study |
| PlacA – lacZ | MG1655 Δ (lacI-promoter of lacZ), replaced with pneumococcus lacA promoter region, kanR | This study |
| PlacR-2 – lacZ | MG1655 Δ (lacI-promoter of lacZ), replaced with pneumococcus lacR-2 promoter region, kanR | This study |
| PlacAΔoperator – lacZ | MG1655 Δ (lacI-promoter of lacZ), replaced with pneumococcus lacA promoter region with 20-base pair deletion of the predicted LacR-2 operator, kanR | This study |
| Plasmids | ||
| pG+host9 | 4.8 kb pAMβ1 derivative conferring erythromycin resistance. Low copy, termosensitive ori | van Opijnen and Camilli, 2012 |
| pG+host9-HPr | pG+host9 with hpr and promoter region cloned in using SmaI and XhoI sites | This study |
| pDL993 | p15A ori, WT pLac promoter, lacI with native promoter, tetR | Courtesy of David Lasinski |
| pDL993_lacR-2 | pDL993 with lacR-2 cloned downstream of the pLac promoter using SmaI and EcoRI sites | This study |