Skip to main content
. Author manuscript; available in PMC: 2016 Jul 8.
Published in final edited form as: Oncogene. 2015 Oct 19;35(25):3335–3341. doi: 10.1038/onc.2015.382

Figure 4. Enhanced β-catenin/Tcf4 activity Ncad KO KC.

Figure 4

Immunohistochemical analysis of β-catenin (antibody from Invitrogen) (A) and Tcf4 (antibody from Millipore) (B) expression on adjacent sections of 6-month old control, Ncad WT, and Ncad KO pancreata. Note the corresponding increase in both β-catenin and Tcf4 in cells from adjacent sections in Ncad KO. (C) Quantification of Tcf4-positive nuclei in mPanIN lesions. (D) qPCR of β-catenin/Tcf4 target genes axin2 and MMP7 in pancreata from control (n=3), Ncad WT (n=8), and Ncad KO (n=6) mice. Total RNA was isolated from pancreas tissue disassociated into single cells using RNeasy Mini Kit (Qiagen). Expression of the target gene was compared with the expression level of GAPDH. Primer sequences used were Axin2 forward: 5´ AGCCGCCATAGTC 3´, Axin2 reverse: 5´ GGTCCTCTTCATAGC 3´; MMP7 forward: 5' GCAAGGAGAGATCATGGAGACAGCTT 3', MMP7 reverse: 5' AAGTTCACTCCTGCGTCCTCACCAT 3'; GAPDH forward: 5’ CCACTCTTCCACCTTCGATG 3’, GAPDH reverse: 5’ TCCACCACCCTGTTGCTGTA 3’. (E) Immunoblot analysis of N-cadherin and cyclin D1 (antibody from Santa Cruz) in total protein lysates of PDEC isolated from Ncad WT and Ncad KO mice. (F) Immunoblot analysis of β-catenin in total lysate, cytoplasmic, and nuclear fractions prepared from PDEC isolated from Ncad WT and Ncad KO mice. Lamin B1 (antibody from Abcam) served as a control for enrichment of the nuclear fraction.