[Table/Fig-2]:
Details of primers used for PCR amplification in the study.
| Primer Name | Sequences 5’-3’ | Genome position | Amplicon size bp |
|---|---|---|---|
| E1-F1 | GCTCCGCGTCCTTTAC | 10389bp–10943pb | 555 |
| E1-R1 | ATGGCGACGCCCCCAAAGTC |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.