Table 1.
Gene symbol | Chromo-some | HGVS DNA reference | HGVS protein reference | Variant type | dbSNP/COSMIC ID | Comment | Pre-tx depth | Pre-tx allelic ratio | Post-tx depth | Post-tx allelic ratio | Normal depth | Normal allelic ratio |
---|---|---|---|---|---|---|---|---|---|---|---|---|
FUBP1 | Chr1 | g.chr1:78422351C>T | p.W537* | Stop Gained | n/a | Pre-tx only | 107 | 0.26 | 132 | 0 | 61 | 0 |
RNF212 | Chr4 | g.chr4:1079732A>G | p.L105S | Missense | n/a | Pre-tx only | 99 | 0.32 | 153 | 0 | 94 | 0 |
RP1 | Chr8 | g.chr8:55541441TC>T | p.S1667fs | Frameshift | n/a | Pre-tx only | 125 | 0.04 | 267 | 0 | 163 | 0 |
CPXM2 | Chr10 | g.chr10:125622146C>T | p.G166E | Missense | n/a | Pre-tx only | 39 | 0.08 | 53 | 0 | 49 | 0 |
CACNA1C | Chr12 | g.chr12:2788661C>T | p.R1704W | Missense | rs373996684 | Pre-tx only | 184 | 0.18 | 322 | 0 | 175 | 0 |
ABCC9 | Chr12 | g.chr12:22005137C>A | p.G888V | Missense | n/a | Pre-tx only | 72 | 0.18 | 182 | 0 | 102 | 0 |
NTS | Chr12 | g.chr12:86272172G>A | p.C62Y | Missense | n/a | Pre-tx only | 89 | 0.15 | 266 | 0 | 108 | 0 |
CACNA1H | Chr16 | g.chr16:1252074G>A | p.E542K | Missense | n/a | Pre-tx only | 58 | 0.07 | 158 | 0 | 35 | 0 |
AMFR | Chr16 | g.chr16:56396967G>A | p.R596C | Missense | n/a | Pre-tx only | 33 | 0.09 | 29 | 0 | 28 | 0 |
SPEN | Chr1 | g.chr1:16259731CCAGAAAACAACCCGAT>C | p.QKTTRS2333fs | Frameshift | n/a | Both | 138 | 0.35 | 184 | 0.66 | 122 | 0 |
SYT6 | Chr1 | g.chr1:114640393C>T | p.A406T | Missense | rs142164979 | Both | 61 | 0.23 | 83 | 0.29 | 42 | 0 |
ZDBF2 | Chr2 | g.chr2:207175047G>A | p.R1932H | Missense | COSM2150473 | Both | 173 | 0.21 | 209 | 0.42 | 145 | 0 |
YEATS2 | Chr3 | g.chr3:183515744C>T | p.P1044L | Missense | rs376025260 | Both | 70 | 0.21 | 115 | 0.30 | 58 | 0 |
CCDC71L | Chr7 | g.chr7:106300865T>G | p.S160R | Missense | n/a | Both | 13 | 0.23 | 17 | 0.35 | 15 | 0 |
KIAA1045 | Chr9 | g.chr9:34971537G>A | p.R81Q | Missense | rs374394658 | Both | 139 | 0.18 | 173 | 0.39 | 97 | 0 |
CCDC180 | Chr9 | g.chr9:100092618C>G | p.P659A | Missense | n/a | Both | 107 | 0.26 | 148 | 0.38 | 93 | 0 |
CNNM1 | Chr10 | g.chr10:101090101G>C | p.E319D | Missense | n/a | Both | 158 | 0.15 | 189 | 0.35 | 132 | 0 |
MICAL2 | Chr11 | g.chr11:12278507A>G | p.D1044G | Missense | n/a | Both | 34 | 0.29 | 50 | 0.36 | 23 | 0 |
KDM4E | Chr11 | g.chr11:94760214A>G | p.N498S | Missense | n/a | Both | 69 | 0.13 | 63 | 0.33 | 35 | 0 |
TSPAN8 | Chr12 | g.chr12:71526521A>T | p.D176E | Missense | n/a | Both | 182 | 0.18 | 287 | 0.37 | 180 | 0 |
CORO6 | Chr17 | g.chr17:27942821C>T | p.V450M | Missense | n/a | Both | 122 | 0.25 | 171 | 0.32 | 92 | 0 |
AKAP1 | Chr17 | g.chr17:55183750AGCTTGGATAGAAATGAGGAGG>A | p.SLDRNEEG309S | Codon Deletion | COSM1244721 | Both | 151 | 0.11 | 181 | 0.06 | 84 | 0 |
NOTCH3 | Chr19 | g.chr19:15280935A>T | p.W1721R | Missense | n/a | Both | 12 | 0.50 | 12 | 0.25 | 10 | 0 |
CPAMD8 | Chr19 | g.chr19:17017774C>T | p.A1386T | Missense | n/a | Both | 148 | 0.23 | 159 | 0.37 | 104 | 0 |
ZNF420 | Chr19 | g.chr19:37618255A>G | p.N121S | Missense | n/a | Both | 99 | 0.21 | 244 | 0.35 | 134 | 0 |
ZNF473 | Chr19 | g.chr19:50550059A>T | p.R787* | Stop Gained | n/a | Both | 180 | 0.26 | 205 | 0.36 | 135 | 0 |
KRTAP10-3 | Chr21 | g.chr21:45978592T>C | p.T3A | Missense | rs452472 | Both | 13 | 0.62 | 7 | 0.43 | 0 | 0 |
HTRA2 | Chr2 | g.chr2:74757932T>A | p.L232Q | Missense | n/a | Post-tx only | 256 | 0.00 | 225 | 0.23 | 103 | 0 |
LRAT | Chr4 | g.chr4:155665556T>A | p.S26R | Missense | n/a | Post-tx only | 352 | 0 | 235 | 0.03 | 169 | 0 |
CREB3 | Chr9 | g.chr9:35736430T>G | p.Y275D | Missense | n/a | Post-tx only | 87 | 0 | 81 | 0.07 | 68 | 0 |
ALOX5 | Chr10 | g.chr10:45907697T>G | p.L164V | Missense | n/a | Post-tx only | 280 | 0 | 219 | 0.05 | 133 | 0 |
KNDC1 | Chr10 | g.chr10:135013889G>T | p.E972* | Stop Gained | n/a | Post-tx only | 87 | 0 | 62 | 0.15 | 45 | 0 |
SLITRK6 | Chr13 | g.chr13:86368728T>TA | p.Y639Lfs | Frameshift | n/a | Post-tx only | 278 | 0 | 762 | 0.14 | 175 | 0 |
PML | Chr15 | g.chr15:74336964G>C | p.R755P | Missense | n/a | Post-tx only | 471 | 0 | 363 | 0.07 | 235 | 0 |
ARHGAP35 | Chr19 | g.chr19:47423891GC>AA | p.P654T | Missense | n/a | Post-tx only | 217 | 0 | 179 | 0.13 | 109 | 0 |
RRP1 | Chr21 | g.chr21:45213265C>T | p.R114C | Missense | n/a | Post-tx only | 196 | 0 | 136 | 0.14 | 83 | 0 |
HGVS, Human Genome Variation Society; dbSNP, Database of Single Nucleotide Polymorphisms; COSMIC, Catalogue of Somatic Mutations in Cancer; Pre-tx, pretreatment sample; Post-tx, postprogression sample; n/a, not applicable.