Extended Data Figure 2. Arl13b-mCherry-GECO1.2 transgenic mouse.

a, Transgene orientation and integration site. The transgene was integrated into the noncoding region of Chromosome 1 (pos. 174,611,500). b, The genotype of transgenic animals was determined by PCR using primers 372-up: ACATGGCCTTTCCTGCTCTC, 372-down: TTCAACATTTCCGTGTCGCC and 944-down: GACATCTGTGGGAGGAGTGG. The PCR product for wt genomic sequence was ~800 bp; the transgene PCR product was ~400 bp. c, mIMCD cells isolated from Arl13b-mCherry-GECO1.2^tg mice were imaged after permeabilisation with 15 µM digitonin in varying extracellular [Ca²⁺]. Average ratios (n = 12 cilia per each data point) are plotted vs. free [Ca²⁺]. Arl13b-mCherry-GECO1.2 calibration fitted by a Boltzmann curve (R² = 0.98; k_D = 442 nM). d, Phenotype of Arl13b-mCherry-GECO1.2^tg/tg mice. Mouse organ morphology/orientation appeared normal (situs inversus was not observed) and breeding animals had normal litter sizes (6–8 for C57Bl/6⁴¹). All error bars ± SEM.