Skip to main content
. 2016 May 3;6:25199. doi: 10.1038/srep25199

Table 1. Mutation frequencies of the FVII gene in transfected cells induced by tru-RGNs and std-RGNs.

ID gRNAs Target sites (5′-3′)* Length(nt) Sites inexon 2 Mutation frequency(%) Mean ± SEM
F7–1 AAGGCGTGCCAACTCACTCC TGG 20 43–63 23.6 ± 0.5a
tF7–1 GGCGTGCCAACTCACTCC TGG 18 45–63 12.1 ± 0.2b
F7–2 GCGTGCCAACTCACTCCTGG AGG 20 46–66 30.1 ± 0.9a
tF7–2 GTGCCAACTCACTCCTGG AGG 18 48–66 49.5 ± 1.0b
F7–3 GGAGCTTTGGCCCGGCTCTC TGG 20 67–87 10.9 ± 1.3
tF7–3 GCTTTGGCCCGGCTCTC TGG 17 70–87 7.7 ± 0.9b

a,b values with the different numbers within the same column showed significant differences (P < 0.05). The statistical comparison was performed in pair between std-RGNs and tru-RGNs, that was F7–1 vs. tF7–1, F7–2 vs. tF7–2, F7–3 vs. tF7–3 (n = 3). *Either TGG or AGG at 3′-end of each gRNAs was shown as protospacer adjacent motif (PAM) necessary for gRNA recognition. The target sites were counted from the first nucleotide of exon 2 in FVII (GenBank Accession No. U66079, as shown in Fig. 1S A).