Table 1. Mutation frequencies of the FVII gene in transfected cells induced by tru-RGNs and std-RGNs.
| ID gRNAs | Target sites (5′-3′)* | Length(nt) | Sites inexon 2 | Mutation frequency(%) Mean ± SEM |
|---|---|---|---|---|
| F7–1 | AAGGCGTGCCAACTCACTCC TGG | 20 | 43–63 | 23.6 ± 0.5a |
| tF7–1 | GGCGTGCCAACTCACTCC TGG | 18 | 45–63 | 12.1 ± 0.2b |
| F7–2 | GCGTGCCAACTCACTCCTGG AGG | 20 | 46–66 | 30.1 ± 0.9a |
| tF7–2 | GTGCCAACTCACTCCTGG AGG | 18 | 48–66 | 49.5 ± 1.0b |
| F7–3 | GGAGCTTTGGCCCGGCTCTC TGG | 20 | 67–87 | 10.9 ± 1.3 |
| tF7–3 | GCTTTGGCCCGGCTCTC TGG | 17 | 70–87 | 7.7 ± 0.9b |
a,b values with the different numbers within the same column showed significant differences (P < 0.05). The statistical comparison was performed in pair between std-RGNs and tru-RGNs, that was F7–1 vs. tF7–1, F7–2 vs. tF7–2, F7–3 vs. tF7–3 (n = 3). *Either TGG or AGG at 3′-end of each gRNAs was shown as protospacer adjacent motif (PAM) necessary for gRNA recognition. The target sites were counted from the first nucleotide of exon 2 in FVII (GenBank Accession No. U66079, as shown in Fig. 1S A).