Table 4. De novo identified motifs and their conservation between pathways and species.
We tested the reference motif list for pathway conservation and between species conservation. For each motif, we computed the enrichment in known TFBSs databases and reported the corresponding significant TFs. It appears that several TFs may be acting cooperatively to regulate the expression of cyclic genes. We also noticed motif conservation between mouse and chicken as opposed to zebrafish where any of the discovered motifs could be found in the promoters of known cyclic genes. The conservation between species is given in terms of percentage of reported cyclic genes of the species with the corresponding motif in their promoter region.
| Motifs | Possible TFs | Best possible match (5’-3’) | Related GO terms (Biological Process) | Wnt- Notch- Fgf | chicken | Zebrafish |
|---|---|---|---|---|---|---|
| A1 | (E2F1/PLAG1)—(EGR1/ RREB1); E2F1—ZNF263; PLAG1—EGR2 | CGGGCGGCCAGGGGGGGGGGGGGCGGGGGCGGGGG | Multicellular organismal development; Developmental process; System development | W2-N1-F1 | Yes (74%) | No |
| A2 | - | CACCCACGCACACACACGCACACACACACACACCC | Cellular developmental process; Anatomical structure development; Multicellular organismal development | W1-N8-** | No | No |
| A3 | SP2, PREB1, ZNF263, EGR1, E2F3, EGR2 | CCCCCCCCCCCCCCCCCCCGC | Anatomical structure morphogenesis; Chordate embryonic development; Organ morphogenesis | W3-N2-F4 | Yes (63%) | No |
| A4 | - | AAAAAAAAAAAAAAAAAAAAAAACCAACA | Primary metabolic process; Metabolic process; Cellular metabolic process | W4-N4-F3 | No | No |
| A5 | SP2, EGR1, PREB1, SP1, EGR2 | CCCCCACCCCCCCCCCGCCCC | Developmental process; Multicellular organismal development; Anatomical structure development | W2-N3-F2 | Yes (58%) | No |
| A6 | - | CCGCCCCCGGGAGGCGGAGGCAGGCG | Cellular protein metabolic process; Protein metabolic process; Cellular macromolecule metabolic process | **-N5-** | No | No |
| A7 | - | CCCTCGCTCTGCAGGCCGGGCTGGCCCCC | RNA processing; Metabolic process; Cellular metabolic process | W5-N10-F1 | No | No |
| A8 | (ZNFF263/E2F6)—EGR1 | GCGGGCGGGAGGGGGGGAGAGGGGGAGAG | Neuron projection development; Cell development; Neuron projection morphogenesis | W2-N7-F5 | Yes (50%) | No |
| A9 | - | CGCGCGGTCTCCCCGGGGCGCCCTGGCCG | Cellular metabolic process; RNA metabolic process; Primary metabolic process | W5-**-** | Yes (50%) | No |
| A10 | SP2, PREB1, EGR1 | CCCCCCCCACCCCCC | Forebrain development; Central nervous system development; Brain development | W2-N3-F2 | No | No |
| N6 | - | GGGCAGGGCCGTGCCCCCACCCCGG | Anatomical structure development; Negative regulation of RNA metabolic process; Cellular macromolecule metabolic process | **-N6-** | No | No |
| N9 | Tcf3, NHLH1, Ets1 | GCCCAGCTGCTGCCCCGGGGG | System development; Negative regulation of transcription from RNA polymerase II promoter; Negative regulation of transcription, DNA-dependent | **-N9-** | No | No |