Table 1.
The primers used for quantitative PCR in this study
| Gene | Name | Sequence (5′–3′) | Thermal profile | No. cycles | Product size (bp) | Reference |
|---|---|---|---|---|---|---|
| nirK | nirKF1aCu | ATCATGGTSCTGCCGCG | 30 s-95 °C, 95 °C-15 s, 55 °C-30 s, 72 °C-30 s, 80 °C-30 s |
1 | 473 | Henry et al. (2004) |
| nirKR3Cu | GCCTCGATCAGRTTGTGGTT | 95 °C-5 s, 58 °C-34 s, 72 °C-15 s 95 °C-15 s, 55 °C-30 s, 72 °C-30 s, 80 °C-30 s | 40 | |||
| nosZ | nosZ-F | AGAACGACCAGCTGATCGACA | 30 s-95 °C, s, 80 °C-30 s |
1 | 300 | Scala and Kerkhof (1998) |
| nosZ-R | TCCATGGTGACGCCGTGGTTG | 95 °C-5 s, 60 °C-34 s, 72 °C-15 s 95 °C-15 s, 55 °C-30 s, 72 °C-30 s, 80 °C-30 s |
40 | |||
| 16S rRNA | 515F | GTGCCAGCMGCCGCGG | 30 s-95 °C, | 1 | 392 | Zhou et al. (2011) |
| 907R | CCGTCAATTCMTTTRAGTTT | 95 °C-5 s, 55 °C-34 s, 72 °C-15 s 95 °C-15 s, 55 °C-30 s,72 °C-30 s, 80 °C-30 s | 40 |
M A/C, R A/G