. 2016 May 25;6:26655. doi: 10.1038/srep26655

Table 1. Human or swine TTV- specific PCR assays used for the assessment of the human and swine sera.

PCR	PCR Type	Target	Forward Primer	Reverse Primer	Size (bp)	BLASTresults
Pan-Human TTV	qPCR	Untranslated region (Conserved)	5′gtaagtgcacttccgaatggctgag3′	5′gcccgaattgcccttgac3′	132	^a AB041007.1
						^a AF122915.1
						^b KJ082064.1
						^b AY590626.1
Pan-TTSuV UTR 1	qPCR	Untranslated region (Conserved)	5′cgaatggctgagtttatgcc3′	5′gataggccccttgactccg3′	95	^a KR054745.1
						^a,^b KR131718.1
						^b HM633251.1
						^b KR054745.1
TTSuV1- UTR 2	Gel-based	Untranslated region (Conserved)	5′gcggtcaaaatggcggaag3′	5′ggacttgagctcccgaccaa3′	124	^a EU564163.1
						^a JF451574.1
						^b EU006509.1
						^b JX872390.1
TTSuV1-ORF2	Gel-based	ORF2 (Variable)	5′agtcaagcttttgccggaacactgggaggaag3′	5′acgtctcgagccagccatcgtcgccgat3′	235	^a JX535326.1
						^a HM633254.1
						^b HM633254.1
						^b JX535326.1
TTSuV1-ORF3	Gel-based	ORF3 (Variable)	5′gcgacgatggctgtttggaggtgaaataccaaccc3′	5′acgtctcgaggcgtttcttttgttttttat3′	477	^a HM633244.1
						^a HM633254.1
						^b HM633254.1
						^b JX535326.1

^aTop 2 nucleotide BLAST results obtained from the sequenced PCR amplicons two swine samples.

^bTop 2 nucleotide BLAST hits obtained from the sequenced PCR amplicons of two human samples.