Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Gene names and sequences of primers.
| Gene Name | IL-1β |
| Forward Primer Sequences | GCTGCTTCCAAACCTTTGAC |
| Reverse Primer Sequence | GCTTGTGCTCTGCTTGTGAG |
| Gene Name | β-Actin |
| Forward Primer Sequences | CATGAGGCTTATATCCTTGC |
| Reverse Primer Sequence | TAAAAGGCACTTTGTCCACT |
