Skip to main content
. 2015 Jan 17;8:2. doi: 10.1186/s12284-014-0039-9

Table 5.

Primers for InDel markers and SNP markers developed

Primer Forward (5’-3’) Reverse (5’-3’) Product length (bp) Annealing temperature (°C)
INDEL7-1 tcgataaaagttcagtttgacggc actttttcatccgcgacgaatatc 68 (62)* 55
INDEL7-2 tgaagtggcatgatccatctacac tgtactgcactgcagtggatgc 81 (75)* 55
INDEL7-3 tttttagattatttacttcacg taatcaagaaggacttttgag 65 (69)* 50
SNP7-1 tcggattcaatgtgtcactctc acatgctactagttattcctcgtaaac 111 58
SNP7-2 tgacgcattctcgatggagtc tatcggggacttgttctcattc 80 58
SNP7-3 aggaataccagatgctgttgtcg aactccccctccagtgtagcc 78 60
SNP7-4 tcaaagacatgacatcacgacac cagagcacctataagtaacagtctaac 84 58
SNP7-5 tcattagcacatatttattgtagcacc gaaaaaaccaattacacagattgc 106 60

*Number in brackets indicates the product length of PA64s.