Table 5.
Primers for InDel markers and SNP markers developed
Primer | Forward (5’-3’) | Reverse (5’-3’) | Product length (bp) | Annealing temperature (°C) |
---|---|---|---|---|
INDEL7-1 | tcgataaaagttcagtttgacggc | actttttcatccgcgacgaatatc | 68 (62)* | 55 |
INDEL7-2 | tgaagtggcatgatccatctacac | tgtactgcactgcagtggatgc | 81 (75)* | 55 |
INDEL7-3 | tttttagattatttacttcacg | taatcaagaaggacttttgag | 65 (69)* | 50 |
SNP7-1 | tcggattcaatgtgtcactctc | acatgctactagttattcctcgtaaac | 111 | 58 |
SNP7-2 | tgacgcattctcgatggagtc | tatcggggacttgttctcattc | 80 | 58 |
SNP7-3 | aggaataccagatgctgttgtcg | aactccccctccagtgtagcc | 78 | 60 |
SNP7-4 | tcaaagacatgacatcacgacac | cagagcacctataagtaacagtctaac | 84 | 58 |
SNP7-5 | tcattagcacatatttattgtagcacc | gaaaaaaccaattacacagattgc | 106 | 60 |
*Number in brackets indicates the product length of PA64s.