Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers for real time PCR analysis
| Gene | Primer | Forward (5’-3’) | Reverse (5’-3’) | Product length (bp) |
|---|---|---|---|---|
| LOC_Os07g41180 | RT-1 | gcatccattgttgaggagaaacg | cacctctgttgtcttgctggaac | 112 |
| LOC_Os07g41190 | RT-2 | cctcaagatgaatgggaatgtgcgt | tacacttccttgtcctgagatccca | 116 |
| LOC_Os07g41200 | RT-3 | gagaatgccccaagtcccatctc | ctgttcgggttccagcactc | 116 |
| OsActin1 | RT-4 | ccattggtgctgagcgttt | cgcagcttccattcctatgaa | 70 |
