Table 2. Identification of new miRNAs.
Canonical and non-canonical miRNAs. nd = not detectable in RNAseq. The miRNA ddi-mir-7097 was identified by Avesson et al. 2012 but only with very low read counts and lack of the miRNA-3p.The exact 5’ and 3’end may deviate by a few nucleotides. Relative expression levels of miRNAs in different strains are shown based on RNA-sequencing data. Reads were extracted from the genomic positions given in S4 Table (+/- 5 nucleotides) and divided by the total read number. Data were then normalized for AX2.
| *miRNA | sequence [nt] | criteria | relative expression | ||
|---|---|---|---|---|---|
| *miRNA | AX2 | rbdB- | agnA- | ||
| known miRNAs | |||||
| ddi-miR-1176-5p [9] | CCAAUUUUUAUCAAGGAAAGC | 1,2,3,4,5,6 | 16,00 | 3,30 | 1341,16 |
| ddi-miR-1176-3p | CUUCCUUGACAAAAAUUGCCC | 1,00 | 0,00 | 1,11 | |
| ddi-miR-1177-5p [9] | CCAGUUAGGGUUUAAUGGUUC | 1,2,3,4,5,6 | 3,00 | 0,00 | 36,52 |
| ddi-miR-1177-3p | ACCGUUGAGCCCUUUCUGAUU | 7,00 | 0,00 | 167,09 | |
| identified canonical miRNAs | |||||
| miRNA_can_D1-5p | UCUUUCUCUAAUUUCAUUUAUU | 1,2,3,4,5,6 | 54,00 | 0,00 | 588,69 |
| miRNA_can_D1-3p | AAAUGAAAUUAGAGAAAGGGAU | 8,00 | 1,65 | 79,67 | |
| miRNA_can_D2-5p | UUCUCGACAGACAUAGCAUUGG | 1,2,3,4,5,6 (in rrpC- and agnA-) | 14,00 | 1,65 | 915,13 |
| miRNA_can_D2-3p | AAUGCUUAGAUGUAGAGGAAAC | 0,00 | 0,82 | 9,96 | |
| ddi-mir-7097-5p [8] | UCUCUACUAGUGCCGAAAUCA | 1,2,3,4,5,6 | 66,00 | 12,36 | 2599,33 |
| ddi-mir-7097-3p | UUUGGCAGAAGUAGAGACGAA | 10,00 | 5,77 | 590,91 | |
| miRNA_can_D3-3p | AUUAAUUUCGGCAGCCAUAUU | 1,2,3,4,5,6 | 68,00 | 3,30 | 185,90 |
| miRNA_can_D3-5p | UAUGGCUGCUGAAAUUAAUGUGG | 47,00 | 26,37 | 369,59 | |
| non-canonical miRNA | |||||
| miRNA-like_D4 | UCGAACUAGUCCAAUCUUUAAU | 1,2,3 (based on NB), 6, no hairpin | 12,00 | 754,68 | 24,72 |
As an example, validation (criteria 5 and 6) is shown for the canonical miRNA_can_D1 and for the non-cononical miRNA-like D4 (Fig 10).