Table 1.
The information of HbTCTP experimentally validated by degradome analysis.
| HbTCTP | |||||||
|---|---|---|---|---|---|---|---|
| SiteID | CL1994Contig3:25 | CL1994Contig3:25 | CL18Contig4:316 | CL18Contig4:316 | CL18Contig13:280 | CL18Contig13:280 | CL18Contig13:280 |
| Query | acc_635132_22 | acc_635132_22 | acc_298609_20 | acc_81739_20 | acc_298609_20 | acc_298609_20 | acc_298609_20 |
| Query GenBank accession | KX230767 | KX230767 | KX230768 | KX230769 | KX230768 | KX230768 | KX230768 |
| miRNA homology | ppt-miR1023b-3p | ppt-miR1023b-3p | ptc-miRf12236-akr | ptc-miRf12236-akr | ptc-miRf12236-akr | ptc-miRf12236-akr | ptc-miRf12236-akr |
| Transcript | CL1994Contig3 | CL1994Contig3 | CL18Contig4 | CL18Contig4 | CL18Contig13 | CL18Contig13 | CL18Contig13 |
| Transcript GenBank accession | KX230764 | KX230764 | KX230765 | KX230765 | KX230766 | KX230766 | KX230766 |
| TStart | 12.0 | 12.0 | 303.0 | 303.0 | 267.0 | 267.0 | 267.0 |
| TStop | 34.0 | 34.0 | 325.0 | 325.0 | 289.0 | 289.0 | 289.0 |
| TSlice | 25.0 | 25.0 | 316.0 | 316.0 | 280.0 | 280.0 | 280.0 |
| MFEperfect | −34.6 | −34.6 | −31.5 | −31.5 | −31.5 | −31.5 | −31.5 |
| MFEsite | −22.7 | −22.7 | −20.6 | −20.6 | −20.6 | −20.6 | −20.6 |
| MFEratio | 0.65606936416185 | 0.65606936416185 | 0.65396825396825 | 0.65396825396825 | 0.65396825396825 | 0.65396825396825 | 0.65396825396825 |
| AllenScore | 10.0 | 10.0 | 11.5 | 11.5 | 11.5 | 11.5 | 11.5 |
| Paired | 3-5,32-30;8-18,27-17;19-22,15-12 | 3-5,32-30;8-18,27-17;19-22,15-12 | 4-17,322-309;18-20,305-303 | 4-17,322-309;18-20,305-303 | 4-17,286-273;18-20,269-267 | 4-17,286-273;18-20,269-267 | 4-17,286-273;18-20,269-267 |
| Unpaired | 1-2,34-33[UP5];6-7,29-28[SIL];x-x,16-16[BULt] | 1-2,34-33[UP5];6-7,29-28[SIL];x-x,16-16[BULt] | 1-3,325-323[UP5];x-x,308-306[BULt] | 1-3,325-323[UP5];x-x,308-306[BULt] | 1-3,289-287[UP5];x-x,272-270[BULt] | 1-3,289-287[UP5];x-x,272-270[BULt] | 1-3,289-287[UP5];x-x,272-270[BULt] |
| Structure | ((((.(((((((((((.(((.&.))).)))))))))))-)))) | ((((.(((((((((((.(((.&.))).)))))))))))-)))) | (((…((((((((((((((…&…))))))))))))))—))) | (((…((((((((((((((…&…))))))))))))))—))) | (((…((((((((((((((…&…))))))))))))))—))) | (((…((((((((((((((…&…))))))))))))))—))) | (((…((((((((((((((…&…))))))))))))))—))) |
| Sequence | CUCUCGCGCUCUCUUUUU UUCCC& AAGAAUUGAAGAGAGUGU-AGAG | CUCUCGCGCUCUCUUUUUUUCCC&AAGAAUUGAAGAGAGUGU-AGAG | CCAAAUUUUUGGGGGGGGGAGAG&CAUUCCUCUUCCUAAAA—UGG | CCAAAUUUUUGGGGGGGGGAGAG&CAUUCCUCUUCCUAAAA—UGG | CCAAAUUUUUGGGGGGGGGAGAG&CAUUCCUCUUCCUAAAA—UGG | CCAAAUUUUUGGGGGGGGGAGAG&CAUUCCUCUUCCUAAAA—UGG | CCAAAUUUUUGGGGGGGGGAGAG&CAUUCCUCUUCCUAAAA—UGG |
| DegradomeCategory | 2 | 3 | 4 | 4 | 4 | 4 | 4 |
| DegradomePval | 0.057064826793158 | 0.043840735949404 | 0.043696995831537 | 0.040822193474199 | 0.079977935468352 | 0.085484564218372 | 0.11412318662399 |
| Librairy | bark | leaf | root | latex | latex | root | leaf |
| Length | 22 | 22 | 20 | 20 | 20 | 20 | 20 |
SiteID, a unique name for a putative splicing site in the form of “[transcript]:[slice_site]”; Query, small RNA accession; miRNA homology, column added by the authors with the best hit after blasting the small RNA sequence against PMRD database (Zhang et al., 2010); Tstart, one-based start position of the alignment within the transcript; Tstop, one-based stop position of the alignment within the transcript; Tslice, one-based position of the alignment opposite position 10 of the query; MFEperfect, minimum free energy of a perfectly matched site (approximate); MFEsite, minimum free energy of the aligment in question; MFEratio, MFEsite/MFEperfect; AllenScore, penalty score calculated by Allen (Allen et al., 2005); Paired, string representing paired position in the query and transcript; Unpaired, string representing unpaired positions in the query and transcript; Structure, aligned secondary structure; Sequence, aligned sequences of transcript and query; Degradome category, category 4: just one read at this position; category 3: >1 read, but below or equal to the average depth of coverage on the transcript; category 2: >1 read, equal to the average depth of coverage on the transcript; category 1: >1 read, equal to the maximum of the average depth of coverage on the transcript when there is >1 position at maximum value; category 0: >1 read, equal to the maximum of the average depth of coverage on the transcript when there is just one position at maximum value; DegradomePval, p-value for this degradome hit; Library, column added by the authors, name of the tissue from which degradome library was sequenced; Length, column added by the authors, small RNA length in nucleotide.