TABLE 1.
List of bacterial strains and primers used in this study
| S. pneumoniae strain or primer | Details or primer sequence | Source, reference, or primer use |
|---|---|---|
| Strain | ||
| D39 | Serotype 2, NCTC 7466 | 1a |
| 0100993 | Serotype 3, clinical isolate | 42 |
| cia spc 136b | R6 mariner mutant of CiaR | 28 |
| D39ΔciaR | D39 with mariner insertion in ciaR | This work |
| 0100993 ΔciaR | 0100993 with replacement of ciaR with ermAM | 42 |
| D39ΔhtrA | D39 with replacement of htrA with spec cassette | 18 |
| D39/pAL2YI | D39 with the empty pAL2YI vector | This work |
| D39/phtrA+ | D39 with pAL2-HtrA plasmid | This work |
| D39ΔhtrA/phtrA+ | D39ΔhtrA complemented with pAL2-HtrA | This work |
| D39ΔciaR/phtrA+ | D39ΔciaR complemented with pAL2-HtrA | This work |
| Primer | ||
| MP144 | CGAACCAAGCTGGAATATCT | PCR of CiaR/H; upstream of ciaR (28) |
| MP145 | AACCATGTCAGGATCGTAGT | PCR of CiaR/H; downstream of ciaH (28) |