Skip to main content
Molecular Genetics and Metabolism Reports logoLink to Molecular Genetics and Metabolism Reports
. 2016 Jun 11;8:13–16. doi: 10.1016/j.ymgmr.2016.06.001

First report of inherited thyroxine-binding globulin deficiency in Iran caused by a known de novo mutation in SERPINA7

Fahimeh Soheilipour a, Hassan Fazilaty b,1, Fatemeh Jesmi c, William A Gahl d,e, Babak Behnam b,d,e,⁎,2
PMCID: PMC4909823  PMID: 27331012

Abstract

Background

Thyroxine-binding globulin (TBG) is the main transporter of thyroid hormones in human serum, encoded by the gene TBG (SERPINA7), located in long arm of X-chromosome (Xq21-q22). Deficiency of SERPINA7 (serum protease inhibitor, clade A [alpha-1 antiproteinase, antitrypsin], member 7) leads to inherited TBG deficiency. Several mutations have been reported in the coding and noncoding regions of SERPINA7 in association with TGB deficiency.

Methods

Automated chemiluminescence immunoassays were used to determine TSH, free and total T4 and T3 (fT4, TT4, TT3) and TBG. Direct DNA sequencing identified the mutation in SERPINA7.

Results

We present a 3 and 4/12 year old boy, born premature, who was mismanaged as hypothyroidism before referral to our center, and was diagnosed with TBG deficiency at our center with a hemizygous substitution in exon 1, position c.347T > A, leading to replacement of isoleucine for arginine in position 96 (considering the first 20 amino acid signal peptide).

Conclusion

This known mutation, reported as the first SERPINA7 mutation in Iran, emphasizes the point that endocrinologists should pay more attention to inherited TBG to prevent unnecessary treatment.

Keywords: TBG, SERPINA7, Mutation, Iran

1. Introduction

Thyroxine-binding globulin (TBG) is the main transporter of thyroid hormones in human serum. TBG is encoded by the serum protease inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 (SERPINA7), the TBG gene, located on the long arm of the X-chromosome (Xq21-q22). SERPINA7 loss of function mutations leads to inherited abnormalities of serum TBG that are either a complete (TBG-CD), partial (TBG-PD), or excessive (TBG-E). Since SERPINA7 resides on the X chromosome, women with homozygous inactivating mutations and men hemizygous for a deleterious mutation usually manifest as TBG-CD, and heterozygous women as partial [1], [2]. Gene duplication or triplications have been associated with TBG-E [3].

Inherited defects of TBG do not cause thyroid disease or altered metabolism. Rather, total thyroid hormone (TH) concentrations in serum are altered while free TH remains unchanged. Medical risks associated with TBG deficiency are minimal if free TH levels are monitored, but unrecognized deficiencies may lead to unsuitable treatment and complications [4]. Based on published reports, the frequency of TBG deficiency varies from 1 in 1200 to 15,000 newborns; the exact frequency is likely underestimated due to lack of ability to detect heterozygous females and males with TBG-PD [5].

TBG is a glycoprotein consisting of 415 amino acids with four N-linked units of oligosaccharide, synthesized in the liver. The SERPINA7 gene (OMIM + 314,200) contains 4 coding exons, spanning ~ 7.5 kb in the human genome. Several mutations in the coding and noncoding regions, of SERPINA7 have been reported in association with TGB deficiency [5], [6]. In this article we present the first case report of TBG deficiency in Iran.

2. Case presentation

The patient was a 3-year-and-four-month old boy, when seen in the endocrinology clinic with thyroid dysfunction. At the first visit, he could talk, walk, and run; his height and weight were at the 10%, and he had near normal intelligence.

In his past medical history, the boy was born at 27 weeks and 6 days of gestation with a weight of 760 g and an Apgar of 5 and 7 at one and five minutes. He was resuscitated and received Continuous Positive Airway Pressure (CPAP) along with prophylactic surfactant due to respiratory distress syndrome (RDS) at birth. He underwent laser therapy for prematurity retinopathy and was hospitalized for 100 days in NICU after birth. The proband had a TSH of 2.4 mIU/mL (normal range: 0.2–8.0 mIU/mL) and a T4 of 2.1 μg/dL (normal range: 6–14.7 μg/dL) at one month of age, treated with 25 μm of levothyroxine daily. At 22 months, his TSH was 0.3 mIU/L and his T4 was 3.0 μg/dL; the values reached 1.6 mIU/L and 4.0 μg/dL, respectively, at 24 months of age. At 28 months, the TSH and T4 were 3.1 mIU/L and 2.4 μg/dL, respectively. A complete blood count (CBC) test in his 30-month age showed a normal pattern. The measured levels of thyroid hormones are demonstrated in Table 3. Thyroid hormones were measured by electrochemiluminescence method with Elecsys 2010 Roche HITACHI instrument.

Table 3.

The detailed thyroid hormones of the patient in different intervals.

Age Lab item (NL range)
TSH, mIU/ml
(0.2–8.0)
T4, μg/dl
(6–14.7)
T3, ng/ml
(0.75–2.0)
fT4, pmol/l
(10.29–36.03)
T3RU, %
(25–35%)
FTI
(1.12–4.37)
T3RIA, ng/dL
(80–200)
T4RIA, μg/dL
(4.5–12.5)
1 month 1.5 12.87 40 1.9
2 months 2.4 2.1 0.99 25.74 31 70 3.3
4 months 5.8 2.2 0.6 35
19 months 0.1 5.0 0.9 41.0
22 months 0.3 3.0 0.7 23.4 37.7 1.13
24 months 1.6 4.0 30.2 40.1 1.70
28 months 3.1 2.4 0.6
30 months (4 weeks after stopping levothyroxine) 10.1 3.0 0.8 4.3 36.5 1.10
36 months (with 1/4 pills levothyroxine) 5.0 3.3 10.1 36.5 1.20
40 months 4.4 2.9 1.0 14.157 33

Upon referral to our center, the TSH and T4 levels were 10.1 mIU/L and 3.0 μg/dL, respectively. After assuring that the patient and family were compliant, it was concluded that the levothyroxine dosage (25 mg four days a week) had no effect on serum levels of thyroid hormones; the TSH remained 4.4 mIU/L and the T4 2.9 μg/dL. This prompted an investigation for genetic disorders. This study was performed in the Molecular Genetics Laboratory of Ali-Asghar Children's Hospital, Iran University of Medical Sciences, in accordance with the Declaration of Helsinki. An informed consent was obtained from the parents on behalf of the child.

3. SERPINA7 gene analysis

Genomic DNA was extracted from peripheral blood cells, using a standard phenol-chloroform protocol. All four coding exons of the SERPINA7 gene, including intron-exon boundaries, were amplified by polymerase chain reaction (PCR) utilizing the primers listed in Table 1. Single strand sequencing was performed using standard ABI3730 system (Applied Biosystems, Macrogen, South Korea) with both forward and reverse primers. Sequencing results were analyzed using Chromas version 2.4.1 software, and were aligned to the published template (ENSG00000123561) using Clustal Omega software (EMBL-EBI). Result showed a hemizygous substitution in exon 1, position c.347T > A; p.I116N (p.I96N by numbering from the first amino acid of the mature protein and consider the signal peptide as − 1 to − 20). The chromatogram and aligned sequence are shown in Fig. 1A–B. This change leads to substitution of a hydrophobic amino acid (isoleucine) to a polar amino acid (asparagine). After diagnosis of this mutation, treatment for the patient was tapered and he is currently (after two years) not receiving levothyroxine treatment and is in good condition.

Table 1.

Primer pairs for SERPINA7.

Primer symbol Primer sequence
SERPINA-1F TGCATCTCCTGTTTTTCAAGG
SERPINA-1R TGTCCAGTGGAGCAGATCAC
SERPINA-2F TGGGAGACCATGACAAATGAC
SERPINA-2R GTTTGTTGATGTGCTTGGATG
SERPINA-3F CCCTACTCCCAGTGCTTCAG
SERPINA-4R TCAGCCAGGGTTCAATCTTC

Fig. 1.

Fig. 1

Analysis of SERPINA7 exon 1 sequencing. A. Aligned sequence of the patient with published template (ENSG00000123561) in Clustal Omega software. B. Corresponding chromatogram (Chromas software version 2.4.1) for the region containing alterations. Red arrow shows the substituted nucleotide. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

4. Discussion

This study reports the first case of TBG deficiency in Iran with TBG-CD. Regarding the fact that the patient was born premature, decision on low levels of serum T4 was not enough for initiating the treatment, as it may be due to physiologic hypothyroxinemia of prematurity [7]. For premature infants with puzzling thyroid hormone tests, FT4 is a better evaluation that should have been considered for the present patient to avoid unnecessary treatment for more than two years, which might unnecessarily predispose the infant to the adverse effects of the drug. When the patient was first visited by our team, molecular genetic analysis revealed a hemizygous substitution, c.347T > A; p.I116N (p.I96N in mature protein); thus, levothyroxine was tapered and discharged.

Isoleucine 96 resides in a highly conserved domain of the protein that is preserved among human, chimpanzee, mouse, rat, pig, bovine and sheep, and is a site of glycosylation. This variant, which is known as TBG-Gary, has been previously reported (http://www.ncbi.nlm.nih.gov/clinvar/variation/9790/) and associated with severe TBG deficiency. This alteration damages a potential glycosylation domain by creating a new site (Asn-Cys-Ser), therefore results in encoding a protein with impaired T4 binding ability and severe instability that causes rapid denaturation [8]. This mutation is known to cause TBG-PD, however in our hemizygote case, it leads to complete deficiency (TBG-CD).

In TBG-CD serum concentration for TBG is usually below 5 mg/L, while in TBG-PD it overlaps the normal concentration in heterozygote females. To date, about 45 mutations have been described to cause TGB deficiency, mostly in coding regions [5], [6], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19], [20], [21], [22], [23], [24], [25], [26], [27], [28], [29], [30], [31], [32], [33], [34], [35], [36] (Table 2) (recently reviewed by Pappa et al. [31]). There does not appear to be a “hot spot”; missense and nonsense mutations are scattered in coding regions and splice sites. The majority of alterations that lead to TBG-CD are nonsense mutations that drastically change the amino acid sequence and consequently the proper function of protein [5]. Some reports also described mutations in non-coding regions, which mostly affect mRNA splicing [9], [18]. Recently, in four families that showed no mutations in SERPINA7, Ferrara and colleagues discovered a new variant 20 kb downstream of the gene. This alteration resides within a liver-specific enhancer, leading to reduction in the activity and consequently the expression of the SERPINA7 [6].

Table 2.

Reported (non-large deletion) mutations in SERPINA7 gene.

Region Mutation Reference
Exon1 S23T [10]
S23X [11]
D28fsX51 [12]
R35W [32]
R35E [33]
T38fsX51 [13]
P50fs51X [28]
S52N [14]
S52R [31]
S61C [31]
A64D [27]
E74K [31]
I96N [8] & Present study
N112L [31]
A113P [15]
V165fsX168 [16]
D171N [17]
188fsX195 [18]
Exon 2 T191A [19]
D201fsX206 [29]
V215G [34]
Q223X [11]
L227P [20]
N233I [35]
Exon 3 W280X [11], [14]
W280fsX325 [9]
L283fsX321 [21]
L283F [20]
Y309P [22]
Exon 4 A329fsX374 [21]
H331Y [23]
K332fsX374 [31]
L352fsX374 [24]
P363L [25], [26]
D368G [31]
S370F [36]
Y381fsX396 [4]
R381G [31]
S382R [31]
382fsX384 [21]
L384fsX402 [30]
Non-coding g.IVS1,+2_3insT [5]
H(− 2)Y [9]
+ 20 kb G > A [6]
IVS1 + 2 T > C [30]

Conflict of interest

The authors declare no conflict of interest.

Acknowledgements

BB and FS visited the patient, collected data, and drafted the manuscript; BB designed the experiment and confirmed the molecular analysis. FJ completed and edited the manuscript, and HF performed the PCR and analyzed the sequence data.

This work was supported in part by the Intramural Research Program of the National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland, USA (Common Fund).

References

  • 1.Refetoff S. Thyroxine-binding globulin: organization of the gene and variants. Horm. Res. 1996;45(3–5):128–138. doi: 10.1159/000184775. [DOI] [PubMed] [Google Scholar]
  • 2.Refetoff S. Inherited thyroxine-binding globulin abnormalities in man. Endocr. Rev. 1989;10(3):275–293. doi: 10.1210/edrv-10-3-275. [DOI] [PubMed] [Google Scholar]
  • 3.Mori Y. Gene amplification as a common cause of inherited thyroxine-binding globulin excess: analysis of one familial and two sporadic cases. Endocr. J. 1999;46(4):613–619. doi: 10.1507/endocrj.46.613. [DOI] [PubMed] [Google Scholar]
  • 4.Refetoff S., Selenkow H.A. Familial thyroxine-binding globulin deficiency in a patient with Turner's syndrome (XO). Genetic study of a kindred. N. Engl. J. Med. 1968;278(20):1081–1087. doi: 10.1056/NEJM196805162782002. [DOI] [PubMed] [Google Scholar]
  • 5.Mannavola D. TBG deficiency: description of two novel mutations associated with complete TBG deficiency and review of the literature. J Mol Med (Berl) 2006;84(10):864–871. doi: 10.1007/s00109-006-0078-9. [DOI] [PubMed] [Google Scholar]
  • 6.Ferrara A.M. A novel mechanism of inherited TBG deficiency: mutation in a liver-specific enhancer. J. Clin. Endocrinol. Metab. 2015;100(1):E173–E181. doi: 10.1210/jc.2014-3490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Fisher D.A. The hypothyroxinemia [corrected] of prematurity. J. Clin. Endocrinol. Metab. 1997;82(6):1701–1703. doi: 10.1210/jcem.82.6.4030. [DOI] [PubMed] [Google Scholar]
  • 8.Mori Y. A mutation causing reduced biological activity and stability of thyroxine-binding globulin probably as a result of abnormal glycosylation of the molecule. Mol. Endocrinol. 1989;3(3):575–579. doi: 10.1210/mend-3-3-575. [DOI] [PubMed] [Google Scholar]
  • 9.Reutrakul S. Complete thyroxine-binding globulin (TBG) deficiency in two families without mutations in coding or promoter regions of the TBG genes: in vitro demonstration of exon skipping. J. Clin. Endocrinol. Metab. 2002;87(3):1045–1051. doi: 10.1210/jcem.87.3.8275. [DOI] [PubMed] [Google Scholar]
  • 10.Bertenshaw R. Sequencing of the variant thyroxine-binding globulin (TBG)-San Diego reveals two nucleotide substitutions. Biochim. Biophys. Acta (BBA) - Mol. Basis Dis. 1992;1139(4):307–310. doi: 10.1016/0925-4439(92)90105-v. [DOI] [PubMed] [Google Scholar]
  • 11.Domingues R. Two novel variants in the thyroxine-binding globulin (TBG) gene behind the diagnosis of TBG deficiency. Eur. J. Endocrinol. 2002;146(4):485–490. doi: 10.1530/eje.0.1460485. [DOI] [PubMed] [Google Scholar]
  • 12.Ueta Y. A novel mutation causing complete deficiency of thyroxine binding globulin. Clin. Endocrinol. 1997;47(1):1–5. doi: 10.1046/j.1365-2265.1997.2181030.x. [DOI] [PubMed] [Google Scholar]
  • 13.Miura Y. A novel mutation causing complete thyroxine-binding globulin deficiency (TBG-CD-Negev) among the Bedouins in southern Israel. J. Clin. Endocrinol. Metab. 2000;85(10):3687–3689. doi: 10.1210/jcem.85.10.6899. [DOI] [PubMed] [Google Scholar]
  • 14.Su C.C. Two novel mutations in the gene encoding thyroxine-binding globulin (TBG) as a cause of complete TBG deficiency in Taiwan. Clin. Endocrinol. 2003;58(4):409–414. doi: 10.1046/j.1365-2265.2003.01730.x. [DOI] [PubMed] [Google Scholar]
  • 15.Janssen O.E., Takeda K., Refetoff S. Sequence of the variant thyroxine-binding globulin (TBG) in a Montreal family with partial TBG deficiency. Hum. Genet. 1991;87(2):119–122. doi: 10.1007/BF00204164. [DOI] [PubMed] [Google Scholar]
  • 16.Li P. Complete thyroxine-binding globulin (TBG) deficiency caused by a single nucleotide deletion in the TBG gene. Metabolism. 1991;40(11):1231–1234. doi: 10.1016/0026-0495(91)90221-h. [DOI] [PubMed] [Google Scholar]
  • 17.Waltz M. Molecular basis for the properties of the thyroxine-binding globulin-slow variant in American blacks. J. Endocrinol. Investig. 1990;13(4):343–349. doi: 10.1007/BF03349576. [DOI] [PubMed] [Google Scholar]
  • 18.Carvalho G.A., Weiss R.E., Refetoff S. Complete thyroxine-binding globulin (TBG) deficiency produced by a mutation in acceptor splice site causing frameshift and early termination of translation (TBG-Kankakee) 1 2. J. Clin. Endocrinol. Metab. 1998;83(10):3604–3608. doi: 10.1210/jcem.83.10.5208. [DOI] [PubMed] [Google Scholar]
  • 19.Takeda K. Sequence of the variant thyroxine-binding globulin of Australian aborigines. Only one of two amino acid replacements is responsible for its altered properties. J. Clin. Investig. 1989;83(4):1344. doi: 10.1172/JCI114021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mori Y. Replacement of Leu227 by Pro in Thyroxine-Binding Globulin (TBG) is associated with complete TBG deficiency in three of eight families with this Inherited defect. J. Clin. Endocrinol. Metab. 1990;70(3):804–809. doi: 10.1210/jcem-70-3-804. [DOI] [PubMed] [Google Scholar]
  • 21.Reutrakul S., Janssen O.E., Refetoff S. Three novel mutations causing complete T4-binding globulin deficiency. J. Clin. Endocrinol. Metab. 2001;86(10):5039–5044. doi: 10.1210/jcem.86.10.7916. [DOI] [PubMed] [Google Scholar]
  • 22.Janssen O.E. Molecular and structural characterization of the heat-resistant thyroxine-binding globulin-Chicago. J. Biol. Chem. 1995;270(47):28234–28238. doi: 10.1074/jbc.270.47.28234. [DOI] [PubMed] [Google Scholar]
  • 23.Bertenshaw R., Takeda K., Refetoff S. Sequencing of the variant thyroxine-binding globulin (TBG)-Quebec reveals two nucleotide substitutions. Am. J. Hum. Genet. 1991;48(4):741. [PMC free article] [PubMed] [Google Scholar]
  • 24.Yamamori I. Nucleotide deletion resulting in frameshift as a possible cause of complete thyroxine-binding globulin deficiency in six Japanese families. J. Clin. Endocrinol. Metab. 1991;73(2):262–267. doi: 10.1210/jcem-73-2-262. [DOI] [PubMed] [Google Scholar]
  • 25.Shirotani T. Thyroxine-binding globulin variant (TBG-Kumamoto): identification of a point mutation and genotype analysis of its family. Endocrinologia japonica. 1992;39(6):577–584. doi: 10.1507/endocrj1954.39.577. [DOI] [PubMed] [Google Scholar]
  • 26.Miura Y. Impaired intracellular transport contributes to partial thyroxine-binding globulin deficiency in a Japanese family. J. Clin. Endocrinol. Metab. 1994;79(3):740–744. doi: 10.1210/jcem.79.3.8077354. [DOI] [PubMed] [Google Scholar]
  • 27.Sklate R. Novel mutation p. A64D in the Serpina7 gene as a cause of partial thyroxine-binding globulin deficiency associated with increases affinity in transthyretin by a known p. A109T mutation in the TTR gene. Hormone and metabolic research = Hormon-und Stoffwechselforschung = Hormones et metabolisme. 2014;46(2):100–108. doi: 10.1055/s-0033-1358741. [DOI] [PubMed] [Google Scholar]
  • 28.Ferrara A.M. Coexistence of THRB and TBG Gene mutations in a Turkish family. J. Clin. Endocrinol. Metab. 2013;98(6):E1148–E1151. doi: 10.1210/jc.2013-1413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lacka K. A novel mutation (del 1711 G) in the TBG gene as a cause of complete TBG deficiency. Thyroid. 2007;17(11):1143–1146. doi: 10.1089/thy.2007.0023. [DOI] [PubMed] [Google Scholar]
  • 30.Moeller L.C. C-terminal amino acid alteration rather than late termination causes complete deficiency of thyroxine-binding globulin CD-NeuIsenburg. J. Clin. Endocrinol. Metab. 2006;91(8):3215–3218. doi: 10.1210/jc.2005-2261. [DOI] [PubMed] [Google Scholar]
  • 31.Pappa T., Ferrara A.M., Refetoff S. Inherited defects of thyroxine-binding proteins. Best Pract. Res. Clin. Endocrinol. Metab. 2015;29(5):735–747. doi: 10.1016/j.beem.2015.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lima C.J.G. Endocrine Society's 97th Annual Meeting and Expo., March 5–8, 2015 - San Diego. 2015. FRI-068: a novel variant in the SERPINA7 gene is associated with TBG partial deficiency in a woman and her two male siblings. ( http://press.endocrine.org/doi/abs/10.1210/endo-meetings.2015.THPTA.10.FRI-068) [Google Scholar]
  • 33.Moeller L. Two novel mutations leading to familial partial and complete thyroxine-binding globulin deficiency. Exp. Clin. Endocrinol. Diabetes. 2007;115(S1):P01_017. [Google Scholar]
  • 34.Moeller L. 14th International Thyroid Congress. 2010. A novel mutation leading to familial partial thyroxine-binding globulin deficiency (TBG Glencoe) [Google Scholar]
  • 35.Domingues R. A novel variant in Serpina7 gene in a family with thyroxine-binding globulin deficiency. Endocrine. 2009;36(1):83–86. doi: 10.1007/s12020-009-9202-2. [DOI] [PubMed] [Google Scholar]
  • 36.Yorifuji T. Identification of a novel variant of the thyroxine-binding globulin (TBG) in a Japanese patient with TBG deficiency. Horm. Res. 1998;50(Suppl. 3):68. [Google Scholar]

Articles from Molecular Genetics and Metabolism Reports are provided here courtesy of Elsevier

RESOURCES