Skip to main content
. 2016 Jun 16;11(6):e0157032. doi: 10.1371/journal.pone.0157032

Table 2. Summary of deletions of nucleotides and their position in the entire sequence of Chinstrap penguin adenovirus (CSPAdV) and Gentoo penguin adenovirus (GPAdV).

Viruses Region (position) Deficient nucleotide sequences
GPAdV Noncoding region in downstream of ORF4 (346-56nt) GCTAGTATAAA
CSPAdVno4 and GPAdVno4 Hexon (724-726nt) CAG
GPAdV E3 (455-465nt) GATGGAACTTACCCCTTTTCT
CSPAdV Noncoding region between fiber and ORF7 (22,750–22,760nt) CTGTTTGGTACAA
GPAdV Noncoding region, immediately before ORF7 (22,847–22,859nt) AAATTATAGAC