Table 2.
Strains, plasmids and synthetic genes used in this study
| Plasmid, strain and synthetic genes | Description | Reference |
|---|---|---|
| Strains | ||
| L. lactis NZ9000 | MG1363 derivative; pepN::nisRK+ | (Kuipers et al., 1998) |
| C. maltaromaticum DSM20730a | Pediocin sensitive strain | (Hiu et al., 1984) |
| Lb plantarum LMAX | Natural pediocin producer, isolated from HOLDBAC Listeria | Danisco |
| L. lactis NZ9000_pSec::nucB | Carry the plasmid pSec which contains the nucB gene under the control of PnisA | This study |
| L. lactis NZ9000_pOri::pedB | Carry the plasmid pOri::pedB which contains the pedB gene under the control of P23 | This study |
| L. lactis NZ9000_pSec::rpedA | Carry the plasmid pSec::rpedA which contains the ΔsppedA gene under the control of PnisA. | This study |
| L. lactis NZ9000_pSec::s‐rpedA | Carry the plasmid pSec::s‐rpedA which contains the sd::ΔsppedA gene under the control of PnisA | This study |
| L. lactis NZ9000_pSec::l‐rpedA | Carry the plasmid pSec::l‐rpedA which contains the leisstcda::ΔsppedA gene under the control of PnisA | This study |
| L. lactis NZ9000_pSec_pOri::pedC | Carry the plasmid pSec which contains the nucB gene under the control of PnisA and pOri::pedC which contains the pedC gene under the control of P23. | This study |
| L. lactis NZ9000_pSec::s‐rpedA_pOri23 | Carry the plasmid pSec::s‐rpedA which contains the sd::ΔsppedA under the control of PnisA and the plasmid pOri23 | |
| L. lactis NZ9000_pSec::s‐rpedA_pOri::pedC | Carry the plasmid pSec::s‐rpedA which contains the sd::ΔsppedA under the control of PnisA and pOri::pedC which contains the pedC gene under the control of P23. | This study |
| C. maltaromaticum DSM20730_pSec::nucB_pOri23 | Pediocin sensitive strain resistant to erythromycin and chloramphenicol | This study |
| Plasmids | This study | |
| pSec::nucB | CmR, PnisA, spusp45, nucB, repA, repC | Bermúdez‐Humarán et al., 2007) |
| pOri23 | ErmR, p23, repD, repE | Que et al., 2000) |
| pOri::pedB | ErmR, p23, pOri23 derivative carrying pedB | This study |
| pSec::rpedA | CmR, pSec derivative carrying spusp45::rpedA and encoding secreted Rpediocin | This study |
| pSec::s‐rpedA | CmR, pSec: derivative carrying spusp45::s‐rpedA and encoding secreted S‐Rpediocin | This study |
| pSec::l‐rpedA | CmR, pSec derivative carrying spusp45::l‐rpedA and encoding secreted L‐Rpediocin | This study |
| pOri::pedC | ErmR, p23, pOri23 derivative carrying pedC | This study |
| Synthetic genes | Amino acid sequence | |
| sd::ΔsppedA | b tctgataaatattatggtaatggagttacttgtggaaaacattcatgttctgttgattggggtaaagctacaacttgtattattaataatggagctatggcatgggctactggtggacatcaaggtaatcataaatgttaa | Genscript |
| leisstcda::ΔsppedA | b ttagaaatttcatcaacatgtgatgctaatattatggtaatggagttacttgtggaaaacattcatgttctgttgattggggtaaagctacaacttgtattattaataatggagctatggcatgggctactggtggacatcaaggtaatcataaatgttaa | Genscript |
a
The strain was from Deutsche Sammlung von Mikroorganismen und Zellkulturen collection.
b
The nucleotide sequences encoding propeptides SD and LEISSTCDA fused to the N‐terminus of pediocin PA‐1 are in bold.