. 2016 Jun 24;27(3):105–112. doi: 10.7171/jbt.16-2703-002

TABLE 1.

Universal PCR Primers for Bacteria 16S rDNA Gene

Primers' name, variable (V) genome region	Primers' sequences of conserved regions, 5′–3′	Escherichia coli nucleotide position	mer	Ta (°C)	Product (pb)
27f and 342r	`GAAGAGTTTGATCATGGCTCAG`	8–27	22	65	350
General V1–V2⁵	`CTGCTGCCTCCCGTAG`	342–358	16	65	350
V4F-517 and V4R-805	`GCCAGCAGCCGCGGTAA`	517–532	17	60	289
General V4⁶	`GACTACCAGGGTATCTAAT`	787–805	19	60	289
Total bacterial 16S	`GTGGTGCACGGCTGTCGTCA`	1047–1067	20	65	142
V7⁷^,¹²^,¹³	`ACGTCATCCACACCTTCCTC`	1175–1189	20	65	142
Consensus sequence of 7 strains; S-D-Bact 1030 and 1519; V7–V8⁷	`TGCATGCCTGTCGTCAGCTC`	1051–1071	20	65	338
	`GACCCGAGAACGTATTCACC`	1370–1389	20	65	338
Lactobacillus spp.	`AGCAGTAGGGAATCTTCCA`	7–27	19	65	340
lac1 and SG-Lab-0677-aA-17⁹^–¹¹	`CACCGCTACACATGGAG`	331–347	17	65	340

Ta, Annealing temperature. Complete genome of the E. coli DH1Ec169 strain was obtained from the Sequence ID: CP012127.1; Lactobacillus plantarum strain S-C2L 16S ribosomal RNA gene was obtained from the Accession Sequence KP056259. Database, National Center for Biotechnology Information, U.S. National Library of Medicine (Bethesda MD, USA).