Table 1:
Nucleotide sequences of quantitative real-time PCR primers designed for the RNase H-dependent PCR
| Gene | Accession information | Quantitative PCR primer (5′–3′) | Amplicon length (bp) | Primer efficiency |
|---|---|---|---|---|
| Arctic grayling nkaα1a | Accession: KJ175158 GI: 645929871 | Forward: GACGCCTCTTGGAATTGArAATTGC/3SpC3/ Reverse: CCAGAATGACGGAGAGGArTTAAGG/3SpC3/ | 98 | 1.89 |
| Arctic grayling nkaα1b | Accession: KJ175159 GI: 645929873 | Forward: GTGGCTGGAGAGTCCAArGCACCC/3SpC3/ Reverse: CGTTCTGGAAGGCTTCTTTrCAACTT/3SpC3/ | 133 | 1.86 |
| Rainbow trout nkaα1a | Accession: AY319391.1 GI: 34812026 | Forward: GCCTCTCGGAATTGAAATTGArTCACTG/3SpC3/ Reverse: GGATGGCAGCCATCCATArGCCCAA/3SpC3/ | 117 | 1.92 |
| Rainbow trout nkaα1b | Accession: AY319390.1 GI: 34812024 | Forward: AAAGAGATTGAGCACTTTATCCArCATCAG/3SpC3/ Reverse: GACAGCTTCCAGCCArGCCATG/3SpC3/ | 107 | 1.95 |
| ef1α | Accession: AF498320.1 GI: 20269865 | Forward: CTGTTGCCTTTGTGCCCATC Reverse: CATCCCTTGAACCAGCCCAT | 82 | 1.96 |
Bold type ‘r(X)’ represents the inserted RNA base. Gene accession information is from the National Center for Biotechnology Information, and primer efficiencies as well as subsequent amplicon lengths are given. Abbreviations: GI, GenInfo Identifier; bp, base pairs.