| Strains |
|
|
| FB-04 |
E. coli W3110 k12, ΔtrpR::FRTΔtnaA::FRTΔpheA::FRT |
[5] |
|
ΔtyrA::FRT, harboring pSTV-03 plasmid |
|
|
B. subtilis ATCC 6051a |
Providing template for sacB
|
ATCC |
|
E.coli CCTCC M 2016009 |
Isolated from the soil |
CCTCC |
| BL(DE3) |
E. coli host for protein expression |
Novagen |
| BL21(DE3)/pET24a-pta
|
BL21(DE3) harboring pET24a-pta
|
This study |
| BL21(DE3)/pET24a-pta1 |
BL21(DE3) harboring pET24a-pta1 |
This study |
| FB-04(Δpta) |
Δpta::kan-sacB; pta deletion mutant derived from strain FB-04 |
This study |
| FB-04(ΔackA)
|
ΔackA::kan-sacB; ackA deletion mutant derived from strain FB-04 |
This study |
| FB-04(pta1) |
pta1 genomic substitution in FB-04 |
This study |
| Plasmids |
|
|
| pKD13 |
Amp and kan markers |
[21] |
| pKD46 |
Amp markers, helper plasmid |
[21] |
| pSTV-03 |
Based on plasmids of pACYC177 and pND707; p15A replicon, kan |
[5] |
|
marker, PR and PL promoters, carrying aroFfbr and trpEfbrD
|
|
| pET24a |
Protein expression vector in E. coli BL(DE3) |
Novagen |
| pET24a-pta
|
pET24a harboring pta
|
This study |
| pET24a-pta1 |
pET24a harboring pta1 |
This study |
| pMD18-T |
Cloning vector |
Novagen |
| pMD-SK |
pMD18-T harboring kan and sacB
|
This study |
|
Primersa
|
|
|
| C-pta
|
5’-aaacatatgtcccgtattattatgctgatcc-3’ |
This study |
|
5’-cccaagcttttactgctgctgtgcagactg-3’ |
|
| P-pta
|
5’-gtgtcccgtattattatgctgatccctaccggaaccagcgtcggtctgac |
This study |
|
attccggggatccgtcgacc-3’ |
|
|
5-ttactgctgctgtgcagactgaatcgcagtcagcgcgatggtgtagacga |
|
|
tgccaataggatatcggcat-3’ |
|
| P-ackA
|
5’-aggtacttccatgtcgagtaagttagtactggttctgaactgcggtagtt |
This study |
|
attccggggatccgtcgacc-3’ |
|
|
5-accgccagctgagctggcggtgtgaaatcaggcagtcaggcggctcgcgt |
|
|
tgccaataggatatcggcat-3’ |
|
| V-ackA
|
5’-atgtcgagtaagttagtact-3’ |
This study |
|
5’-tcaggcagtcaggcggctcgcgt-3’ |
|
| V-pta
|
5’-aagcggctttaggtgcaggc-3’ |
This study |
|
5’-tttactgctgctgtgcagactgaat-3’ |
|
| V-poxB
|
5’-atgaaacaaacggttgcagc-3-3’ |
This study |
|
5’-ttaccttagccagtttgtt-3’ |
|
| SK-kan-sacB
|
F:5’-aaacatatgattccggggatccgtcgacc-3’
|
This study |
|
R:5’-cccaagctttgccaataggatatcggcat-3’
|
|
|
Overlap-F:5’-cgaagcagctccagcctacagcaactttatgcccatgca-3’
|
|
|
Overlap-R:5’-tgcatgggcataaagttgctctaggctggagctgcttcg-3’
|
|
