TABLE 1.
Oligonucleotide probes used in this study
| Probe or microorganisma | Target sequence | % GC | Td (°C) | Tw (°C) | % Washed off at Tw | Reference |
|---|---|---|---|---|---|---|
| S-*-Univ-1390-a-A-18 (Univ1390)b | 5′GACGGGCGGTGTGTACAA3′ | 61.1 | 43 | 57 | ||
| S-D-Bact-0338-a-A-18 (Bact338) | 5′GCTGCCTCCCGTAGGAGT3′ | 66.7 | 55 | 57 | ||
| S-D-Arch-0915-a-A-20 (Arch915) | 5′GTGCTCCCCCGCCAATTCCT3′ | 65.0 | 58 | 57 | ||
| S-D-Euka-0502-a-A-16 (Euka502) | 5′ACCAGACTTGCCCTCC3′ | 62.5 | 52 | 57 | ||
| S-F-GSB-0528-a-A-19 (GSB528)c | 5′TGCCACCCCTGTATCACCG3′ | 63.2 | 67 | 53 | ||
| Pelodictyon luteolum DSM 273 | 3′ACGGUGGGGACAUAGUGGC5′ | 67.5 | 67 | 49.0 | 53 | |
| Chlorobium vibrioforme DSM 262 | 3′-------------------5′ | 66.5 | 67 | 53.0 | 53 | |
| 21ws, 24ws, 25s, 26s | 3′-------------------5′ | NDd | 67 | ND | 53 | |
| S-*-Chlorb I-0440-a-A-20 (Chlorb I 440) | 5′CCGACATGTTCGTCCCTGAC3′ | 60.0 | ||||
| 21ws (in vitro) | 3′GGCUGUACAAGCAGGGACUG5′ | 57.5 | 62 | 86.5 | This study | |
| Chlorobium vibrioforme DSM 262 | 3′-------------C---A--5′ | 55.0 | 62 | 98.5 | This study | |
| Pelodictyon luteolum DSM 273 | 3′----------------GAC-5′ | 53.5 | 62 | 99.0 | This study | |
| S-*-Chlorb II-0842-a-A-20 (Chlorb II 842) | 5′AGCTACGACACTGATCACGA3′ | 50.0 | ||||
| 24ws (in vitro) | 3′UCGAUGCUGUGACUAGUGCU5′ | 57.0 | 57 | 50.0 | This study | |
| Chlorobium phaeovibrioides DSM 1678 | 3′--------------------5′ | ND | 57 | ND | This study | |
| Chlorobium vibrioforme DSM 262 | 3′----A---------------5′ | 44.5 | 57 | 100.0 | This study | |
| Pelodictyon luteolum DSM 273 | 3′----C---------------5′ | 44.5 | 57 | 100.0 | This study | |
| S-*-Chlorb III-0441-a-A-20 (Chlorb III 441) | 5′ATCAGCATGTTCGTCCCTGA3′ | 50.0 | ||||
| 25s, 26s (in vitro) | 3′UAGUCGUACAAGCAGGGACU5′ | 58.5 | 59 | 60.0 | This study | |
| 21ws | 3′-G-CU---------------5′ | ND | 59 | ND | This study | |
| S-C-dProt-0495-a-A-18 (DELTA495a) | 5′AGTTAGCCGGTGCTTCCT3′ | 55.6 | ||||
| Desulfovibrio desulfuricans DSM 642 | 3′UCAAUCGGCCACGAAGGA5′ | 57.5 | 58e | 56.0 | 22 | |
| 10w, 11s, 12ws, 13s, 14s | 3′------------------5′ | ND | 58e | ND | 22 | |
| Desulfobacter latus DSM 3381 | 3′-----------G------5′ | 54.0 | 58e | 83.0 | 22 | |
| S-C-dProt-0495-b-A-18 (DELTA495b) | 5′AGTTAGCCGGCGCTTCCT3′ | 61.1 | ||||
| Desulfobacter latus DSM 3381 | 3′UCAAUCGGCCGCGAAGGA5′ | 59.5 | 59.5 | 50.0 | 22 | |
| 15s | 3′------------------5′ | ND | 59.5 | ND | 22 | |
| Desulfovibrio desulfuricans DSM 642 | 3′----------A-------5′ | 48.0 | 59.5 | 98.0 | 22 | |
| S-*-GNSB-0941-a-A-17 (GNSB941) | 5′AAACCACACGCTCCGCT3′ | 58.8 | ||||
| Chloroflexus aurantiacus DSM 635 | 3′UUUGGUGUGCGAGGCGA5′ | 56.0 | 56 | 50.0 | 13 | |
| Clostridium aceticum DSM 1496 | 3′-----------------5′ | 47.0 | 56 | 100.0 | 13 |
a
Probes are named according to the work of Alm et al. (2). Names in parentheses are the short names used in the text. Designations with “w,” “ws,” and “s” are names of DGGE bands defined in a previous study (19).
b
This probe was used only for normalization of reference SSU rRNA.
c
This probe was modified from the S-F-GSB-0532-a-A-15 (53).
d
ND, not determined.
e
This probe needed a correction because of a lack of clear discrimination between target and nontarget organisms with one mismatch.