Table 7.
Descriptions of reference genes and parameters derived from quantitative real-time polymerase chain reaction analysis.
| Genes | Gene Function | Gene Accession Number | Primer Sequence (Forward/Reverse) | Tm (°C) | Product (bp) | Amplification Efficiency (%) | R2 |
|---|---|---|---|---|---|---|---|
| GAPDH | glycolysis, glucose metabolism | NM 017008.4 | TGCCACTCAGAAGACTGTGG/TTCAGCTCTGGGATGACCTT | 60 °C | 129 | 99.1 | 0.994 |
| 18S | ribosomal protein | NR 046237.1 | GGAGAGGGAGCCTGAGAAAC/CAATTACAGGGCCTCGAAAG | 60 °C | 128 | 109.7 | 0.994 |
| β-actin | structural constituent of cytoskeleton | NM 031144.3 | ATGGATGACGATATCGCTGC/CTTCTGACCCATACCCACCA | 60 °C | 150 | 93.4 | 0.994 |
| 36B4 | structural constituent of ribosome | XM 015505154.1 | CGACCTGGAAGTCCAACTAC/ATCTGCTGCATCTGCTTG | 60 °C | 109 | 100.2 | 0.997 |
| leptin | regulates food intake and energy metabolism | NM 013076.3 | TTTCACACACGCAGTCGGTATC/GGTCTGGTCCATCTTGGACAAA | 60 °C | 101 | 99.2 | 0.997 |
| UCP-1 | participate in nonshivering thermogenesis | NM 012682.2 | GCCTCTACGATACGGTCCAA/TGCATTCTGACCTTCACCAC | 60 °C | 145 | 93.4 | 0.997 |