Table 1.

Primers and amplification conditions for the different PCR-based screenings of genes encoding antibiotics

Antibiotic and genes	Primer sequence	Product bp	Amplification conditions	References
Pyrrolnitrin prnD	PRND1 (GGGGCGGGCCGTGGTGATGGA) PRND2 (YCCCGCSGCCTGYCTGGTCTG)	786	Initial denaturation at 95 °C for 2 min: 30 cycles of 95 °C for 60 s, 68 °C for 60 s and 72 °C for 60 s, final extension at 72 °C for 10 min	De Souza and Raaijmakers (2003)
Phenazine phzA, phzF or phzC, phzD	PHZ1 (GGCGACATGGTCAACGG) PHZ2 (CGGCTGGCGGCGTATTC)	1400	Initial denaturation at 94 °C for 2 min: 25 cycles of 94 °C for 60 s, 56 °C for 45 s and 72 °C for 105 s, final extension at 72 °C for 10 min	Delaney et al. (2001)
Pyoluteorin pltC	PLTC1 (AACAGATCGCCCCGGTACAGAACG) PLTC2 (AGGCCCGGACACTCAAGAAACTCG)	438	Initial denaturation at 95 °C for 2 min: 30 cycles of 95 °C for 60 s, 68 °C for 60 s and 72 °C for 60 s, final extension at 72 °C for 10 min	De Souza and Raaijmakers (2003)
pltB	PltBf (CGGAGCATGGACCCCCAGC) PltBr (GTGCCCGATATTGGTCTTGACCGAG)	800–900	Initial denaturation at 95 °C for 2 min: 30 cycles of 94 °C for 60 s, 58 °C for 45 s and 72 °C for 105 s, final extension at 72 °C for 10 min	Mavrodi et al. (2001)
2,4-Diacetyl-phloroglucinol phlD	B2BF (ACCCACCGCAGCATCGTTTATGAGC) BPR4 (CCGCCGGTATGGAAGATGAAAAAGTC) BPF3 (ACTTGATCAATGACCTGGGCCTGC)	600	Initial denaturation at 95 °C for 3 min: 34 cycles of 95 °C for 60 s, 60 °C for 60 s and 72 °C for 60 s, final extension at 72 °C for 10 min	McSpadden-Gardener et al. (2001)
Regulatory gene gacA	Gaca1 (GBATCGGMGGYCTBGARGC) Gaca2 (MGYCARYTCVACRTCTCTGSTGAT)	425	Initial denaturation at 95 °C for 2 min: 30 cycles of 95 °C for 60 s, 61 °C for 60 s and 72 °C for 60 s, final extension at 72 °C for 10 min	De Souza et al. (2003)