Table 2.
Short Hairpin Sequences Against Id2 RNA Used in This Study
| SiRNA | Sense sequences | Loop | Antisense sequence | Targets |
|---|---|---|---|---|
| Id2-96 | T5′gatgagtctgctctacaaca | ttcaagaga | tgttgtagagcagactcatc3′ | 96–115 |
| B5′gatgagtctgctctacaaca | tctcttgaa | tgttgtagagcagactcatc3′ | ||
| Id2-369 | T5′gcttatgtcgaatgatagca | ttcaagaga | tgctatcattcgacataagc3′ | 369–388 |
| B5′gcttatgtcgaatgatagca | tctcttgaa | tgctatcattcgacataagc3′ | ||
| Id2-96s | T5′gtcgataccttagactcaga | ttcaagaga | tctgagtctaaggtatcgac3′ | Scrambled |
| B5′gtcgataccttagactcaga | tctcttgaa | tctgagtctaaggtatcgac3′ | ||
| Id2-369s | T5′gatttcggatcagaacatgt | ttcaagaga | acatgttctgatccgaaatc3′ | Scrambled |
| B5′gatttcggatcagaacatgt | tctcttgaa | acatgttctgatccgaaatc3′ |
The number after Id2 indicates the first coding region nucleotide recognized by the siRNA. Sense and antisense DNA sequences for the top (T) strand and the bottom (B) strand oligos, loop regions, and complete Id2 coding region targeted by the siRNA are shown. The Id2 shDNA sequences against the coding region of the mouse Id2 gene used in this study were generated using the siRNA Wizard™ and Block-iT™ RNAi designers and confirmed by NCBI nucleotide Blast.