Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
PCR primer and restriction enzyme for SNP assays
| Position | Primers | PCR Product | Restriction enzyme | Fragment sizes |
|---|---|---|---|---|
| −574 A>C | F:AGTACAGATGCATCATCCATG | 444bp | BCC1 | 279,165 |
| rs10515746 (A_C) | R:GTATGCATGAGATGAAACAGG | |||
| −1516 C>A | F:GCCTTGACCAAGTTCATGCT | 404 bp | Bsl 1 | 66;338 ;404 |
| rs10053538 (C_A) | R:ACCACCCCGGATAATTTTGT |
F=forward; R=reverse
