Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Previous ID | Present ID | Sequence (5′-3′) |
|---|---|---|
| cgi-miR-2e | cgi-miR-2a-1 | UAUCACAGCCAGCUUUGAUGA |
| cgi-miR-2d | cgi-miR-2a-2 | UAUCACAGCCAGCUUUGAUGACA |
| cgi-miR-2b | cgi-miR-2b-1 | UAUCACAGCUAGCUUUGAUGAGCU |
| cgi-miR-2c | cgi-miR-2b-2 | GAUCACAGCCAGCUUUGAUGAG |
| cgi-miR-2a | cgi-miR-2d | UAUCACAGCCUGCUUGGAUCAGU |
