Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this study.
| Gene | Sequence |
|---|---|
| PLXND1 | Forward: cagcgctactacaagcagatca Reverse: gctcaaacttgtgctgcagttgtgt |
| SEMA3E | Forward: aagtcagattccatcactgtgacat Reverse: agcaaagtactgttgttctctatgc |
| GAPDH | Forward: tgaaggtcggagtcaacgg Reverse: agagttaaaagcagccctggtg |
