Table 2.

Candidate reference genes were used for the assessment of the expression stability in qPCR analysis

Gene symbol	Accession no.	Name	GO annotation	e-value	Primer sequencec	Amlicon size
ACT11	EE594539.1	Actin-11	Structural constituent of cytoskeleton	1 × 10−66	GTATGGCAACATTGTCCTCAG TGGAGCAACGACCTTGAT	118
U2SURP	EE594692.1	U2snRNP-associated SURP motif-containing protein-like	RNA binding, required for spliceosome assembly to participate in splicing	3 × 10−55	CGTGGATGAGATTGAGAGGAA TGGAGGACTACGGCTTCTA	199
EF1A	EE594715.1	Elongation factor-1 alpha	Translation elongation factor activity	1 × 10−04	TGCTGTCGGTGTCATCAA CTTCCATCAAACGCCTCATT	97
UBQ	EE594598.1	Ubiquitin-like protein	Biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites.	9 × 10−19	CTTGGTCTGCTGTTGTCTTG CACGGTTCACTTATCCATCAC	200
TUB	EE594551.1	Beta-tubulin chain-like	Microtubule-based process and structural constituent of cytoskeleton	5 × 10−20	TGCTGCCTGCTGTATCTT CGGAGGAACTTACTACTACATACT	109
eIF3	Jk671263	Eukaryotic translation initiation factor 3 subunit B-like	Translation initiation factor activity	1 × 10−90	CCGCCATCGCTACTGTCTCC CCTCTTGCGCTCCTGTTCACT	126
GTF	JZ191082.1	General transcription factor 3C polypeptide	Involved in RNA polymerase III-mediated transcription	8 × 10−39	TTCCAAGTGGCCATCAGGTT AAAGGGCTTCCTGCCTCTTG	108
RPS12	JZ191056.1	40S ribosomal protein S12-like	Structural constituent of ribosome involved in RNA methylation, photorespiration, translation	1 × 10−91	TTGGCAGACTCACGAAGG GATGGCGGATCAGGAGAC	147
GAPDH	JN604531.1	glyceraldehyde-3-phosphate dehydrogenase	Dehydrogenase, Oxidoreductase in glycolysis and gluconeogenesis	0.0	TGGGCAAGATTAAGATCGGAAT TTGATGTCGCTGTGCTTCCA	184
RPS3	JZ191044.1	40S ribosomal protein S3-like	Structural constituent of ribosome involved in RNA methylation, photorespiration, translation	2 × 10−59	ATTCACTGGCTGACCGGATG GTGCCAAGGGTTGTGAGGTC	107

Gene names are denoted base on gene ontology and TAIR annotations