Skip to main content
. 2016 Jul 21;7:1065. doi: 10.3389/fpls.2016.01065

FIGURE 3.

FIGURE 3

Polymorphic sites of BnHRc(Br) aligned against the BrHRc allele. An asterisk indicates an identical nucleotide and a dash indicates a gap. Shaded letters are the substitutions in the intron. The numbers at the top indicate the nucleotide position from the start codon of BrHRc allele. Amino acid replacements resulting from nucleotide substitutions are indicated at the bottom. Underlined letters indicate the polymorphism sites between BrHRc and BoHRc. Two insertions were detected, one is TA at nt 314 in the intron from 39 accessions; and the other is presented as i1, an insertion of 31 bp (TTTTTTTTCAATAAATGTTTTTATTTTGTTT) in the intron of HRc from nine accessions. aThe code for this residue in BoHRc is AAT (encoding N), but AGG (encoding R) in BrHRc and changed to AGT (encoding S) in some accessions. bThe insertion of GTC between nt 614 and 615 led to an inserted S (AGT, GT add to the upstream A forming AGT) at aa position 170 in this accession, while aa 171 changed from I to L (CTC, C add to the downstream TC forming CTC) as those at aa 170.