Figure 4.

Motif analysis of OsbZIP23-bound promotors. A and B, The most significant motif identified in the OsbZIP23 binding peaks by discriminative regular expression motif elicitation in OX-OsbZIP23N and ZH11D, respectively. In both data sets, 200 bps around the top of the peak summit were subjected to discriminative regular expression motif elicitation. No significant motifs were found in OsbZIP23-bound promoters in ZH11N. C, EMSA showing ACGTG is required by OsbZIP23 binding to targets. GST-tagged OsbZIP23 was used in the EMSA, and the GST tag was used as a control. ACGTG probe sequence: CACGCGGCGACGCCACGTGTCCCCACCGATCCCGCCGCTCGGCCGACAGGTGGGCCCCA. ACGTG was substituted by AaacG, ACGaa, and ACGTa in the mutant probe and the substitute nucleotide acids were marked with lowercase characters.