| Gene | Primer | seq (5′ --> 3′) |
|---|---|---|
| CXCL12 | Upstream | gttttttattggtttttatttagtttt |
| Downstream | acctttaaccttctcaaactcc | |
| CYP1B1 | Upstream | tttgggttgaggaaggtgtt |
| Downstream | caaccaaccaaccttcacct | |
| GADD45A | Upstream | ggttgagggttggtaggataatt |
| Downstream | cctactttctacactcactcacaaac |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.