TABLE 1.
Primers used for PCR and sequencing
| Oligonucleo- tide name | Oligonucleotide sequence (5′→3′) | Target organism | Target gene (protein) | Nucleotide positions | PCR product size (bp) | Reference or source |
|---|---|---|---|---|---|---|
| BhCs.781p | GGGGACCAGCTCATGGTGG | B. henselae | gltA (citrate synthase) | 782-800a | 379 | 27 |
| BhCs.1137N | AATGCAAAAGAACAGTAAACA | B. henselae | gltA (citrate synthase) | 1160-1139a | ||
| CAT-1 | GATTCAATTGGTTTGAAGGAGGCT | B. henselae | htrA (60-kDa heat shock protein) | 1181-1204b | 418 | 3 |
| CAT-2 | TCACATCACCAGGACGTATTC | B. henselae | htrA (60-kDa heat shock protein) | 1598-1578b | ||
| Koeh48 | ATCCTTAAAGCAGGGGATGC | B. koehlerae | ribC (riboflavin synthase) | 48-67c | 538 | This study |
| Koeh585 | AGCATAACGGGCAAATTGAT | B. koehlerae | ribC (riboflavin synthase) | 585-566c | ||
| BARTON-1 | TAACCGATATTGGTTGTGTTGAAG | Bartonella species | ribC (riboflavin synthase) | 17-40d | 588 | 17 |
| BARTON-2 | TAAAGCTAGAAAGTCTGGCAACATAACG | Bartonella species | ribC (riboflavin synthase) | 604-577d |
a
Positions within the B. henselae gltA sequence (GenBank accession number L38987).
b
Positions within the B. henselae htrA sequence (GenBank accession number L20127).
c
Positions within the B. koehlerae ribC sequence (GenBank accession number AY116634).
d
Positions within the B. koehlerae ribC sequence (GenBank accession number AY116634).