Table 3.
Identification of recurrent alterations in BRCA1 mutant and BRCA1 non-mutant breast cancers.
| Index cases | Recurrence screen | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene | BRCA1/ER-BC | BRCA1/ER+BC | Prediction* | Cosmic | Cancer Gene Census | Novel breast cancer gene** | BRCA1 mutant ER-negative (n=12) | BRCA1 mutant ER-positive (n=4) | non-BRCA1 ER-negative sporadic (n=12) | non-BRCA1 ER-positive sporadic (n=4) | Mutation | Prediction* |
| DAPK3 | 0 | c.703C>T | deleterious | c.646C>T, lung cancer,
NCI-H1770; c.481G>A, ovarian mucinous carcinoma; c.335C>T, large_intestinal adenocarcinoma; c.27G>A, Grade IV astrocytoma; |
N | Y | 1) c.1013_1023 del_GCCTGCGC GAG; 2) c.2T>G | 0 | 0 | 0 | 1) frameshift 2) misssense | 1) trunctating 2) damaging |
| Gene | BRCA1/ER-BC | BRCA1/ER+BC | Prediction | Cosmic | Cancer Gene Census | Novel breast cancer gene** | BRCA1 mutant ER-negative (n=18) | BRCA1 mutant ER-positive (n=2) | non-BRCA1 ER-negative sporadic (n=98) | non-BRCA1 ER-positive sporadic (n=225) | Mutation | Prediction* |
| GATA4 | 0 | c.185A>T | neutral, deleterious | c.1312G>A, Grade IV astrocytoma | N | Y | 0 | 0 | 0 | 3 homozygous deletions (1 BRCA2 mutant) | homozyggous deletion | NA |
| PDE4D | homozygous deletion | 0 | NA | c.1865A>C, breast ductal carcinoma cell line
HCC2157; c.1045-1G>A, Grade IV astrocytoma |
N | N | 1 homozygous deletion | 1 homozygous deletion-familial | 1 homozygous deletion | |||
| TMEM135 | c.360C>T | 0 | deleterious | c.1023G>C, upper aerodigestive
tract; c.199G>C, ovarian serous carcinoma |
N | Y | 2 homozygous deletions | 0 | 0 | 0 | homozyggous deletion | NA |
| CDKN2A/2B | homozygous deletion | 0 | NA | c.?,c.151_457del307,c.151_457del307,c.151_457del307, c.247C>T,c.155T>A,c.?_?del?,c.?_?del?, c.?_?del?,c.1_471del471,c.1_471del471,c.1_471del471, c.1_471del471,c.1_471del471,c.1_471del471,c.1_471del471, c.1_471del471,c.1_471del471,c.1_471del471,c.1_471del471, c.151_457del307,c.1_471del471,c.1_471del471,c.1_471del471, c.1_457del457,c.1_471del471,c.1_471del471,c.1_471del471, c.151_457del307,c.1_471del471,c.1_471del471,c.156G>C, c.156G>C,c.156G>C,c.456_457+25AGGTGAGGACTGATGATCTGAGAATTT>C, c.150+2T>C,c.225delC,c.224C>T,c.318G>A, c.151_457del307,c.1_471del471,c.1_471del471,c.1_471del471, c.1_471del471,c.1_471del471,c.203C>T, breast cancer |
Y | N | 0 | 0 | 1 homozygous deletion | 5 homozygous deletions(3 BRCA2) | homozyggous deletion | NA |
| KIAA1797 | structural variation-interchromosomal fusion | 0 | NA | c.2862G>A, invasive ductal breast
cancer; c.5148T>A, clear cell renal carcinoma; c.2374G>T,c.2212C>G,c.4106G>A,c.2946T>A, c.2516T>A,c.2678G>T,c.378T>C,c.15C>A, serous ovarian cancer |
N | N | 0 | 0 | 0 | 3 homozygous deletions (1 BRCA2 mutant) | homozyggous deletion | NA |
Identification of recurrent somatic genetic alterations identified in the index cases BRCA1/ER-BC and BRCA1/ER+BC in an independent validation series of 16 BRCA1 mutant breast cancers and 16 non-BRCA1 mutant sporadic breast cancers. The complete list of mutations is available in Supplementary Table S2. Recurrent homozygous deletions were identified through re-analysis of publicly available microarray comparative genomic hybridisation datasets of BRCA1 mutant (n=20) and non-BRCA1 mutant (n=323) breast cancers from Jonsson et al.[20].