Table 2.
The primers used for real-time quantitative PCR.
| Genes | GenBank accession number | Primers (5′-3′) | Size (bp) | |
|---|---|---|---|---|
| EGFR | BC094761.1 | Forward | accatccaggaggtggctgg | 440 |
| Reverse | ggatcacacttttgtccctg | |||
|
| ||||
| GBR2 | JX512444.1 | Forward | aagacggcttcattcccaag | 134 |
| Reverse | ctctctcggataagaaaggc | |||
|
| ||||
| PTPN11 | NM_002834.3 | Forward | ttcacactttccgttagaag | 162 |
| Reverse | attgcccgtgatgttccatg | |||
Note: epidermal growth factor receptor (EGFR), growth factor receptor-bound protein 2 (GRB2), and tyrosine-protein phosphatase nonreceptor type 11 (PTPN11).