Table 1.
In-silico evaluation results for selected primers.
| Primer name | Primer sequence 5′ to 3′ | Reference | TM | Coverage of domain | ||
|---|---|---|---|---|---|---|
| Archaea | Bacteria | Eukarya | ||||
| S-D-Arch-0787-a-S-20 | ATTAGATACCCSBGTAGTCC | Yu et al., 2005 | 56.6 | 88.3 | 7.7 | 0 |
| S-D-Arch-0787-a-A-20 | GGACTACVSGGGTATCTAAT | |||||
| S-D-Arch-1043-a-A-16 | GCCATGCACCWCCTCT | Yu et al., 2005 | 54.3 | 82.8 | 0 | 0 |
| S-D-Arch-0519-a-S-15 | CAGCMGCCGCGGTAA | Park et al., 2008 | 54.7 | 95.7 | 94.4 | 92.4 |
| S-D-Arch-1041-a-A-18 | GGCCATGCACCWCCTCTC | Baker et al., 2003 | 60.5 | 81.9 | 0 | 0 |
| S-D-Arch-0349-a-S-17 | GYGCASCAGKCGMGAAW | Takai and Horikoshi, 2000 | 56.4 | 81 | 0 | 0 |
| S-D-Bact-0785-a-A-21 | TACNVGGGTATCTAATCC | Claesson et al., 2010 | 51.8 | 92.1 | 92.3 | 0.8 |
| S-D-Bact-0007-a-S-20 | AGAGTTTGATCCTGGCTCAG | Frank et al., 2007 | 57.3 | 0 | 65.9 | 0 |
| S-D-Bact-0338-a-A-19 | TGCTGCCTCCCGTAGGAGT | Fierer et al., 2008 | 61.0 | 0 | 90.6 | 0 |
| S-D-Bact-0341-b-S-17 | CCTACGGGNGGCWGCAG | Herlemann et al., 2011 | 61.2 | 0.6 | 94.4 | 0 |
| S-D-Bact-0907-a-A-20 | CCGTCAATTCMTTTRAGTTT | Morales and Holben, 2009 | 51.2 | 0.8 | 90.2 | 75.4 |
The TM temperature was calculated using the NEB online tool. The Coverage was estimated using the SILVA TestProbe tool with the sSU-NR database version 123 and refers to the percentage of potentially covered taxa in the different domains allowing non and one mismatch (MM) during primer annealing.