Table 1.
Primer | Sequence 5′→3′ | Position | Use | Amplicon size (bp) | References |
---|---|---|---|---|---|
VHSV | |||||
GB+ | GTCGAAGAAGAGATAGGC | 2796-2813a | RT-PCR | 1171 bp | Einer-Jensen et al., 2004 |
GB- | GTTGGGTCGCCATGTTTCT | 4548-4566a | Einer-Jensen et al., 2004 | ||
VHS Seq10 m-F | CCCTGGGCCTGGCAA | 3975-3989a | Sequencing | – | This study |
VHS Seq10 m-R | TTGCCAGGCCCAGGG | 3975-3989a | Sequencing | – | This study |
GSeq2+ | GCCCATTGCCCCACG | 3592-3606a | Sequencing | – | Einer-Jensen et al., 2004 |
VHS Seq2-R | CGTGGGGCAATGGGC | 3592-3606a | Sequencing | – | This study |
GSeq4+ | CCTTGTGGAAGTCCCTC | 4227-4243a | Sequencing | – | Einer-Jensen et al., 2004 |
VHS Seq4-R | GAGGGACTTCCACAAGG | 4227-4243a | Sequencing | – | This study |
GSeq6- | GCACAGAGTGACTTATCG | 3258-3275a | Sequencing | – | Einer-Jensen et al., 2004 |
VHS Seq6-R | CGATAAGTCACTCTGTGC | 3258-3275a | Sequencing | – | This study |
IHNV | |||||
IHNVfl-FOR | CTCACTCCGTCCAAGACAG | 2928–2946b | RT-PCR/Sequencing | 782 bp | This study |
IHNV-Rev1 | CCTTCACGRCYCGATTGGAG | 3690–3709b | RT-PCR/Sequencing | ||
G1 FOR | AGAGATCCCTACACCAGAGAC | 3523–3543b | RT-PCR/Sequencing | 499 bp | |
IHNV-REV2 | GATGTGGAGAKCGGAACTTG | 4002–4021b | RT-PCR/Sequencing | ||
IHNV IGSeq 5-F | GCACGCCGAGATAATATC | 3954–3971b | RT-PCR/Sequencing | 721 bp | |
IHNVfl-REV | GCCACCTTGTTCTTGTATC | 4656–4674b | RT-PCR/Sequencing |
Sequence, position of binding to the reference sequence, use and amplicon size are reported.
Nucleotide positions where primers bind are in accordance with the sequence of VHSV strain 07–71 under the GenBank accession number AJ233396.
Nucleotide positions where primers bind are in accordance with the IHNV sequence under the GenBank accession number X89213.