Table 3.
PCR primers, annealing temperatures, and product sizes for cDNA used in qRT-PCR
| cDNA | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Anneal, °C | Product, bp |
|---|---|---|---|---|
| oCSH | ataaactccgaatccaaggtc | gttccttttgagtttgccag | 58 | 177 |
| oRPS15 | atcattctgcccgagatggtg | tgctttacgggcttgtaggtg | 58 | 124 |
| oPol II | agtccaacatgctgacggacatga | agccaagtgccggtaattgacgta | 60 | 332 |
| oGAPDH | accactgtccactgccatcac | cctgcttcaccaccttcttga | 60 | 268 |
| oIGF1 | tcgcatctctcttctatctggccctgt | acagtacatctccagcctcctcaga | 62 | 238 |
| oIGF2 | gaccgcggcttctacttcag | aagaacttgcccacggggtat | 62 | 202 |
| oIGFBP1 | tgatgaccgagtccagtgag | gtccagcgaagtctcacac | 62 | 247 |
| oIGFBP2 | caatggcgaggagcactctg | tggggatgtgtagggaatag | 55 | 330 |
| oIGFBP3 | ctcagagcacagacaccca | ggcatatttgagctccac | 54 | 335 |
o, Ovine; PRR15, ribosomal protein S15; Pol II, polymerase II; IGF, insulin-like growth factor; IGFBP, IGF-binding protein.