Abstract
Premise of the study:
Ten polymorphic chloroplast microsatellite (cpSSR) markers were developed and characterized in an endemic and endangered herb, Maianthemum bicolor (Asparagaceae s.l.), for use in conservation genetics.
Methods and Results:
Primer sets flanking each of the 10 cpSSR loci in noncoding regions of the chloroplast genome of M. bicolor were designed. These cpSSR markers were tested on a total of 33 adult individuals from three natural populations in South Korea. The number of alleles per locus ranged from two to three. The unbiased haplotype diversity per locus ranged from 0.061 to 0.682. All markers were successfully transferred to the congeneric species M. japonicum, M. bifolium, and M. dilatatum with polymorphisms among the species.
Conclusions:
The developed cpSSR markers will be useful in assessing the genetic diversity and population structure of M. bicolor and will help to infer its molecular identification, thereby providing a basis for conservation.
Keywords: Asparagaceae s.l., conservation, endangered species, genetic diversity, Maianthemum bicolor, microsatellite
Maianthemum bicolor (Nakai) Cubey (Asparagaceae s.l.) is an endemic perennial herb of South Korea (Oh, 2007). This species is characterized by dioecious flowers and tepal color that is green at the early stage of the flowering period and changes to dark purple as it grows (Yang, 2007). Therefore, it is visually possible to distinguish the species after the flower and fruit appear. Natural populations of M. bicolor are facing extinction due to habitat deterioration, low germination rates, and overexploitation by humans due to the species’ ornamental value (Chang et al., 2005; Lee et al., 2007). In addition, all local populations of M. bicolor growing on the ridges of mountains at altitudes higher than 1300 m above sea level are highly fragmented, and those habitats are isolated with discontinuous distribution (Lee et al., 2007; Oh, 2007). Both in situ and ex situ conservation programs are being undertaken to secure the wild populations (Lee et al., 2007), but neither the extent of genetic diversity nor the population structure of M. bicolor has been clearly analyzed. Thus, there is an urgent need for development of useful molecular markers for conservation genetics.
Although nuclear markers are excellent for use in most population genetic analyses (Ding et al., 2008; Kim et al., 2008; Tang et al., 2008; Guichoux et al., 2011), they are not suitable for phylogenetic and phylogeographic studies above species level due to high substitution rates (Powell et al., 1996). Chloroplast simple sequence repeat (cpSSR) markers are mainly distributed throughout noncoding regions, which show higher sequence variation than coding regions (Powell et al., 1995). Moreover, the cpSSR markers developed from a species are frequently applicable to amplify homologous regions across related taxa (Diekmann et al., 2012). Therefore, cpSSR markers can be applied for conservation genetics of endangered plant species and can be used to determine molecular identification and genetic relationships among closely related species (Clark et al., 2000; Huang et al., 2015) as complementary tools of nuclear markers.
Here, we provide 10 cpSSR markers for M. bicolor to facilitate conservation and molecular identification. These markers were developed from the complete chloroplast genome sequences of M. bicolor and tested on three natural populations. We also examined the transferability of the markers to three congeneric species, M. japonicum (A. Gray) LaFrankie, M. bifolium (L.) F. W. Schmidt, and M. dilatatum (Alph. Wood) A. Nelson & J. F. Macbr.; the former is closely related to M. bicolor and the latter two are more distantly related within the genus (Kim and Kim, unpublished).
METHODS AND RESULTS
To determine the complete chloroplast genome sequences of M. bicolor, we sampled fresh leaf material from Mt. Deogyu, South Korea. Genomic DNA was extracted using a DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA). The chloroplast genome of M. bicolor was sequenced using a genome skimming approach on an Illumina MiSeq sequencer (Illumina, San Diego, California, USA) and assembled with Geneious version 7.13 (Biomatters, Auckland, New Zealand). The chloroplast genome of M. bicolor is 157,176 bp in length. It displays a typical quadripartite structure, with the large single-copy region (85,698 bp, 54.5% of the total genome) separated from the small single-copy region (18,394 bp, 11.7%) by two inverted repeat regions (26,542 bp, 16.9% each). The GC content is 37.6% (Park et al., unpublished).
The cpSSR regions of M. bicolor were searched through the complete chloroplast genome sequence using a tandem repeat search tool in Geneious with the parameters set to ≥7 mononucleotide repeats, ≥4 di- and trinucleotide repeats, and ≥3 tetra-, penta-, and hexanucleotide repeats. A total of 169 repeat motifs were identified in the chloroplast genome, among which the most frequent types were mononucleotide (124 [73.4%]) and dinucleotide (32 [18.9%]), while tri- (3 [1.8%]), tetra- (8 [4.7%]), and pentanucleotides (2 [1.2%]) were rare. Forty-one loci were randomly selected for screening. We designed 41 primer pairs using Primer3 (Rozen and Skaletsky, 1999) under the following criteria: (1) guanine-cytosine content 30–70%, (2) annealing temperature (Ta) 55–65°C, (3) primer size 18–25 bp in length, and (4) amplicon size 150–500 bp in length. To check the amplification success and variability, two individuals from each of three populations of M. bicolor (n = 6; Mt. Deogyu, Mt. Seorak, and Mt. Daeam; Appendix 1) were selected (Appendix 2).
PCR amplification was carried out in a total volume of 25 μL, containing 2.5 μL of 10× PCR buffer (10 mM Tris-HCl [pH 8.3], 1.5 mM MgCl2, and 50 mM KCl), 0.25 mM of each dNTP, 5 μM of each 6-FAM fluorescently labeled forward and unlabeled reverse primer, 1 unit of Taq DNA polymerase, and 100 ng of DNA template. Amplification of genomic DNA was performed on a Veriti thermal cycler (Applied Biosystems, Carlsbad, California, USA). Fragment length polymorphism was detected on an ABI 3730 DNA Analyzer with GeneScan 500 ROX Size Standard (Applied Biosystems). Peak data were analyzed using Peak Scanner version 1.0 (Applied Biosystems). The authenticity of the loci amplified in M. bicolor populations was confirmed by sequencing the representative PCR products on an ABI 3730 automated sequencer (Applied Biosystems) using the amplification primers. Consensus DNA sequences were assembled for each individual using DNA Baser version 3 (Heracle BioSoft SRL, Pitești, Romania). Of the 41 primer pairs screened, 10 primer sets showed length variation in cpSSR regions and were developed further (Table 1); 31 were monomorphic and not developed any further (Appendix 2).
Table 1.
Characteristics of 10 polymorphic chloroplast microsatellite markers developed for Maianthemum bicolor.
| Locus | Primer sequences (5′–3′) | Repeat motif | Ta (°C) | Position | Allele size rangea (bp) | GenBank accession no. |
| MA2 | F: GAATTGGGAGAGATGGCTGA | (AT)3(A)12 | 58 | psbI–trnS_GCU | 326–327 | KU845594 |
| R: TGCTTACTCTCAAACTCTTCGTTT | ||||||
| MA15 | F: TCGATTTATTGAGGCATACTATGAT | (T)10 | 58 | ndhF–rpl32 | 265–266 | KU845595 |
| R: TTCCAATTCAAATGATATGACCA | ||||||
| MA30 | F: TTGTTTCGTTCCATTCGATCT | (T)10 | 59 | rpoC1 intron | 228–229 | KU845596 |
| R: ATGGTCGATCCCGTAACAGA | ||||||
| MA32 | F: TCACGTTGTCCCAAGTGAAA | (A)11 | 60 | rpoB–trnC-GCA | 325–326 | KU845597 |
| R: ATGATCCGATGGGGTACAAA | ||||||
| MA33 | F: GGGTTCGAATCCCTCTCTCT | (A)8 | 59 | psbC–trnS-UGA | 189–190 | KU845598 |
| R: TCCATGACTCCCCTTAGCTG | ||||||
| MA421 | F: GGACCCATTCAGGAACAAGA | (T)11 | 60 | clpP intron | 273–274 | KU845599 |
| R: TTTGGATGCATACGGTTCAA | ||||||
| MA422 | F: GAGATAGGATTGGAATCGACACA | (T)7 | 59 | clpP intron | 200–201 | KU845600 |
| R: CTGAGATATACCATGAGACCAACAA | ||||||
| MA481 | F: GCTTTTATTGCAGCTAAATATCCTTT | (T)7 | 59 | ndhF–rpl32 | 396–397 | KU845601 |
| R: CACGGCAATATGAGCTTATTCA | ||||||
| MA482 | F: AACAAGACATTCTATTACCTAAGAA | (T)9 | 57 | ndhF–rpl32 | 148–150 | KU845602 |
| R: TACCTAACCCATTGCGGAAC | ||||||
| MA483 | F: TTGAGTCGATTTATTGAGGCATAC | (T)2(T/G)(T)7 | 59 | ndhF–rpl32 | 270–271 | KU845603 |
| R: TTCCAATTCAAATGATATGACCA |
Note: Ta = annealing temperature.
Allele sizes are based on 33 individuals of three populations of M. bicolor; see Appendix 1 for population information.
Thirty-three adult individuals from three natural populations of M. bicolor were used to characterize 10 polymorphic cpSSR loci (Table 2). All polymorphic loci are located in the noncoding regions in which the mutations are usually neutral (Table 1). Polymorphism parameters were calculated with POPGENE version 1.31 (Yeh et al., 1997). The allelic variation (A) in 10 cpSSR loci ranged from two to three, while the unbiased haplotype diversity (H) ranged from 0.061 to 0.682, with an average value of 0.409 (Table 2). Ten cpSSR markers amplified a total 21 alleles. Of these, 10 alleles specifically occurred in one or more individuals of each population; four were specific for the Mt. Deogyu population, three for the Mt. Seorak population, and three for the Mt. Daeam population (Table 2). All polymorphic primers developed for M. bicolor were able to successfully amplify cpSSR regions in three congeneric species (M. japonicum, M. bifolium, and M. dilatatum) sampled from two populations in South Korea and showed polymorphisms among the species (Appendix 3).
Table 2.
Number of alleles, haplotype diversity, and allele distribution of 10 polymorphic chloroplast microsatellite markers developed for Maianthemum bicolor.
| Allele distributiona | ||||||||
| Mt. Deogyu (n = 10) | Mt. Seorak (n = 13) | Mt. Daeam (n = 10) | ||||||
| Locus | A | H | Repeat motif | n | Repeat motif | n | Repeat motif | n |
| MA2 | 2 | 0.492 | (AT)3(A)12 | 10 | (AT)3(A)11* | 13 | (TA)3(A)12 | 10 |
| MA15 | 2 | 0.436 | (T)10 | 10 | (T)10 | 13 | (T)9* | 10 |
| MA30 | 2 | 0.511 | (T)9 | 2 | (T)9 | 13 | (T)9 | 10 |
| (T)10* | 8 | |||||||
| MA32 | 2 | 0.458 | (A)11 | 10 | (A)10 | 12 | (A)10 | 10 |
| (A)11 | 1 | |||||||
| MA33 | 2 | 0.436 | (A)8* | 10 | (A)9 | 13 | (A)9 | 10 |
| MA421 | 2 | 0.515 | (T)11 | 8 | (T)12 | 13 | (T)11 | 9 |
| (T)12 | 2 | (T)12 | 1 | |||||
| MA422 | 2 | 0.061 | (T)7 | 9 | (T)7 | 13 | (T)7 | 10 |
| (T)8* | 1 | |||||||
| MA481 | 2 | 0.061 | (T)7 | 10 | (T)7 | 12 | (T)7 | 10 |
| (T)8* | 1 | |||||||
| MA482 | 3 | 0.682 | (T)9* | 10 | (T)7* | 13 | (T)8* | 10 |
| MA483 | 2 | 0.436 | (T)2(T/G)(T)7 | 10 | (T)10 | 13 | T(T/G)(T)7* | 10 |
| Mean | 2.1 | 0.409 | — | — | — | |||
| Total | 21 | 0.775 | — | — | — | |||
Note: A = number of alleles; H = unbiased haplotype diversity; n = number of individuals.
Asterisk denotes specific alleles occurred in one or more individuals of each population.
CONCLUSIONS
The cpSSR markers developed here are useful for formulating an in situ conservation strategy of the endangered M. bicolor populations by estimating the level of genetic diversity and population structure. The cpSSR markers will also be useful to determine the minimum size of the ex situ core collection that captures the genetic diversity of wild populations of M. bicolor. All of the cpSSR markers designed here for amplification of M. bicolor are applicable to other congeneric species and are a means for species verification in combination with morphological identification.
Appendix 1.
Collection data for three populations of Maianthemum bicolor and three congeneric species.
| Species | Locationa | N | Voucher specimensb |
| M. bicolor (Nakai) Cubey | South Korea: Mt. Deogyu, Seolcheon-myeon, Muju-gun, Jeonbuk | 10 | C.Kim 2015-2 |
| South Korea: Mt. Seorak, Buk-myeon, Inje-gun, Gangwon | 13 | C.Kim 2015-42 | |
| South Korea: Mt. Daeam, Buk-myeon, Inje-gun, Gangwon | 10 | C.Kim 2015-101 | |
| M. bifolium (L.) F. W. Schmidt | South Korea: Mt. Deogyu, Seolcheon-myeon, Muju-gun, Jeonbuk | 2 | C.Kim 2015-69 |
| M. dilatatum (Alph. Wood) A. Nelson & J. F. Macbr. | South Korea: Mt. Seorak, Buk-myeon, Inje-gun, Gangwon | 3 | C.Kim 2015-28 |
| M. japonicum (A. Gray) LaFrankie | South Korea: Mt. Deogyu, Seolcheon-myeon, Muju-gun, Jeonbuk | 1 | C.Kim 2015-3 |
| South Korea: Mt. Seorak, Buk-myeon, Inje-gun, Gangwon | 2 | C.Kim 2015-35 |
Note: N = number of samples.
GPS coordinates are not included because this is an endangered species in South Korea.
All voucher specimens are deposited at Gachon University herbarium (GCU), Seongnam, South Korea.
Appendix 2.
Characteristics of 31 monomorphic chloroplast microsatellite primers designed in Maianthemum bicolor.
| Locus | Primer sequences (5′–3′) | Repeat motif | Ta (°C) | Position | Allele size (bp)a |
| MA1 | F: CCCCGGAAACAGAAAGTCCA | (A)11 | 61 | matK-trnK_UUU | 403 |
| R: TCGATCCTTACCAGATCATTCCA | |||||
| MA8 | F: GAGAGGGATTCGAACCCTCG | (AAT)3 | 63 | trnS_GCU-trnG_UCC | 367 |
| R: CCAGTACTTAACCAGGCCGG | |||||
| MA10 | F: TGGCAGTTGAAGGGGAAGTT | (AT)8 | 58 | trnS_GCU-trnG_UCC | 440 |
| R: ACGAATCGCACTTTTACCACT | |||||
| MA13 | F: TCGGTGGAAACCAAATTCTT | (AT)4 | 55 | trnG-UCC-trnR-UCU | 452 |
| R: TCTAATGGATAGGACAGAGGT | |||||
| MA14 | F: TCGGTGGAAACCAAATTCTT | (A)9 | 55 | trnG-UCC-trnR-UCU | 452 |
| R: TCTAATGGATAGGACAGAGGT | |||||
| MA19 | F: TCATAACGTAAACCACCCGCA | (AT)5 | 59 | atpH-atpI | 344 |
| R: TCCTATACCTGTTATGTTTCTTGGA | |||||
| MA21 | F: AACCTTTTCCCGCATCAGGC | (A)10, (AAT)3 | 61 | matK-trnK_UUU | 393 |
| R: CGAGTACTCTACCGTTGAG | |||||
| MA29 | F: GACTACTAGAAAAGTTTTGATGCTT | (AAT)5 | 60 | petN-psbM | 416 |
| R: CATCTATGTAAAAACAGTCAGCCA | |||||
| MA31 | F: TCCTAGTTCGGGACTGACGG | (A)9 | 63 | trnD_GUC-trnY_GUA | 411 |
| R: CGGTTAATGGGGACGGACTG | |||||
| MA34 | F: AGGATTCTTCCTATTTGTGG | (AG)4 | 55 | trnS-UGA | 296 |
| R: TTTTCAAGACCGGAGCTATC | |||||
| MA46 | F: TTGCTGACCAACAGTATCTC | (A)10 | 56 | atpB-rbcL | 385 |
| R: ACGCACTTCACTTACTCACAA | |||||
| MA50 | F: GGTGGTTCAATTCGATGTTG | (A)8 | 56 | accD | 430 |
| R: GTTATCTTCGTTTTGAAGTCAGT | |||||
| MA51 | F: GAGAAACCCCCGGATCCTTT | (AAT)3 | 61 | psbE-petL | 405 |
| R: TTTCAGATACGACGGTAAGAAAAA | |||||
| MA53 | F: GTCAATAAGGAATCGCCAGGC | (AT)7 | 61 | rpl33-rps18 | 377 |
| R: TCAATTCGATCCCCCGATTCA | |||||
| MA56 | F: GTTCGACGTCTCCGAGCTAT | (AAAT)3 | 61 | rpl20-rps12 | 449 |
| R: ACGGACTAACAAGGTCAGCT | |||||
| MA57 | F: AGTCGCACATACACCCTAGT | (AT)4 | 58 | rps12-clpP | 407 |
| R: TAGTTCTTCCGCTTCCAGGA | |||||
| MA61 | F: AACGAGTCACACACTAAGCA | (A)9 | 56 | rpl16-rps3 | 286 |
| R: TCCATTCGACACGTGCAATTT | |||||
| MA64 | F: TGGTCTACAGGGTTCATAAC | (A)8 | 56 | rpl2intron | 430 |
| R: ATCCAAATCTGCCGAATCAC | |||||
| MA69 | F: TCAACCATTTCATTTTACCA | (A)8 | 55 | ycf1-ndhF | 200 |
| R: CACGATTATATGACCAATTGTAT | |||||
| MA70 | F: ATCATTATTGACGGTCCAAGACC | (A)9 | 61 | ndhF-rpl32 | 400 |
| R: CACTTTTATCTAGCTATTTGGTCA | |||||
| MA73 | F: AGTTCCAATTCAAATGATATGACCA | (AAGT)3 | 59 | ndhF-rpl32 | 310 |
| R: TCTGATACTTTCTTATTGGATTGGA | |||||
| MA76 | F: CTTCTTAGGTAATAGAATGTCTTGT | (AT)4 | 62 | ndhF-rpl32 | 435 |
| R: TGACTTCGCTAAAGAGAAAGCT | |||||
| MA77 | F: TTTGTGCGACAAACAAAAACAAA | (A)10 | 56 | rpl32-trnL_UAG | 332 |
| R: CAACTTGGTCTTGAGTTAGGCG | |||||
| MA86 | F: GTTGACGTTTTCCCAGAATT | (AAT)4 | 55 | rps15-ycf1 | 456 |
| R: CAAATCGTTTCTTTGGCCCA | |||||
| MA88 | F: TTCAATAGCTTTGCGTCCGC | (AAACG)3 | 58 | trnR_ACG-rrn5 | 381 |
| R: AAAATAGCTCGACGCCAGAA | |||||
| MA89 | F: AGGCAAAGGGTCGAGAAACT | (A)8 | 58 | trnV_GAC-rps12 | 389 |
| R: TCGAAAAATGAAATGGCGTGG | |||||
| MA90 | F: ACTGGTAGGAGAAGAACCCGA | (A)9 | 61 | trnV_GAC-rps12 | 372 |
| R: TGGACCCTCATGTTGATCCG | |||||
| MA91 | F: CGCAACTCAATCATGTATGATGGA | (AAG)3 | 62 | ycf2 | 394 |
| R: ATGGTTCCTTACTTCGACAGGGT | |||||
| MA92 | F: CTCAACATGAGGGAGGAGAAAGA | (A)8 | 63 | rps19-psbA | 389 |
| R: ATCAACCGTGCTAACCTTGG | |||||
| MA115 | F: AGAGCAATGCCTATTGTACC | (A)10 | 56 | atpA-atpF | 358 |
| R: TAAGGCTTGTTGGAAAACTC | |||||
| MA132 | F: CCTCCTTGAAAGAGAGATGT | (C)8 | 56 | trnE_UUC-trnT_GGU | 354 |
| R: TGGCTTAGTGCGAGATAGTGA |
Note: Ta = annealing temperature.
Allele sizes are based on six individuals from three M. bicolor populations; see Appendix 1 for population information.
Appendix 3.
Comparison of allele distributions of 10 polymorphic cpSSR between Maianthemum bicolor and its congeneric species M. bifolium, M. dilatatum, and M. japonicum.
| Locus | M. bicolora (n = 33) | M. bifolium (n = 2) | M. dilatatum (n = 3) | M. japonicum (n = 3) |
| MA2 | (AT)3(A)12, (AT)3(A)11* | (AT)7(A)4 | (AT)7(A)4 | (AT)3(A)8 |
| MA15 | (T)9, (T)10 | (T)15, (T)16 | (T)14 | (T)9, (T)10 |
| MA30 | (T)9*, (T)10 | (T)11 | (T)10 | (T)11 |
| MA32 | (A)10, (A)11* | (A)9 | (A)10 | (A)9, (A)10 |
| MA33 | (A)8*, (A)9 | (A)11 | (A)9 | (A)10 |
| MA421 | (T)11, (T)12* | (T)10, (T)11 | (T)10 | (T)10 |
| MA422 | (T)7, (T)8* | (T)7 | (T)7 | (T)7 |
| MA481 | (T)7, (T)8* | (T)6, (T)7 | (T)7 | (T)7 |
| MA482 | (T)7, (T)8*, (T)9 | (T)9 | (T)9 | (T)7 |
| MA483 | (T)2(T/G)(T)7, T(T/G)(T)7 | (T)15 | (T)14 | (T)9, (T)10 |
Note: n = number of individuals.
Asterisk denotes specific alleles for M. bicolor.
LITERATURE CITED
- Chang C.-S., Lee H. S., Park T. Y., Kim H. 2005. Reconsideration of rare and endangered plant species in Korea based on the IUCN Red List categories. Journal of Ecology and Environment 28: 305–320 (in Korean, with English abstract). [Google Scholar]
- Clark C. M., Wentworth T. R., O’Malley D. M. 2000. Genetic discontinuity revealed by chloroplast microsatellites in eastern North American Abies (Pinaceae). American Journal of Botany 87: 774–782. [PubMed] [Google Scholar]
- Diekmann K., Hodkinson T. R., Barth S. 2012. New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species. Annals of Botany 110: 1327–1339. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding G., Zhang D., Ding X., Zhou Q., Zhang W., Li X. 2008. Genetic variation and conservation of endangered Chinese endemic herb Dendrobium officinale based on SRAP analysis. Plant Systematics and Evolution 276: 149–156. [Google Scholar]
- Guichoux E., Lagache L., Wagner S., Chaumeil P., Léger P., Lepais O., Lepoittevin C., et al. 2011. Current trends in microsatellite genotyping. Molecular Ecology Resources 11: 591–611. [DOI] [PubMed] [Google Scholar]
- Huang J., Yang X., Zhang C., Yin X., Liu S., Li X. 2015. Development of chloroplast microsatellite markers and analysis of chloroplast diversity in Chinese jujube (Ziziphus jujuba Mill.) and wild jujube (Ziziphus acidojujuba Mill.). PLoS ONE 10: e0134519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim C., Na H. R., Choi H.-K. 2008. Conservation genetics of endangered Brasenia schreberi based on RAPD and AFLP markers. Journal of Plant Biology 51: 260–268. [Google Scholar]
- Lee C. H., Shin C. H., Kim K. S. 2007. Monitoring for population dynamics and conservation of Smilacina bicolor Ohwi in Mt. Sobaek and Taebaek. Proceedings of the international scientific conference of The Plant Resources Society of Korea, 131–132, South Korea. Website http://www.dbpia.co.kr/Issue/VOIS00040442 [accessed 6 July 2016] (in Korean).
- Oh B.-U. 2007. Smilacina Desf. In C.-W. Park , The genera of vascular plants of Korea, 1312–1313. Academy Publishing Co., Seoul, South Korea. [Google Scholar]
- Powell W., Morgante M., McDevitt R., Vendramin G. G., Rafalski J. A. 1995. Polymorphic simple sequence repeat regions in chloroplast genomes: Applications to the population genetics of pines. Proceedings of the National Academy of Sciences, USA 92: 7759–7763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Powell W., Morgante M., Andre C., Hanafey M., Vogel J., Tingey S., Rafalski A. 1996. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding 2: 225–238. [Google Scholar]
- Rozen S., Skaletsky H. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Tang S., Dai W., Li M., Zhang Y., Geng Y., Wang L., Zhong Y. 2008. Genetic diversity of relictual and endangered plant Abies ziyuanensis (Pinaceae) revealed by AFLP and SSR markers. Genetica 133: 21–30. [DOI] [PubMed] [Google Scholar]
- Yang J.-C.2007. Taxonomy of Maianthemum sensu lato (Liliaceae) in Korea. Ms.D. dissertation, University of Chungbuk, Cheongju, South Korea (in Korean, with English abstract).
- Yeh F., Yang R. C., Boyle T. 1997. POPGENE: A user-friendly shareware for population genetic analysis, version 1. 31. Molecular and Biotechnology Center, University of Alberta, Edmonton, Canada. [Google Scholar]