Skip to main content
. Author manuscript; available in PMC: 2017 Jan 1.
Published in final edited form as: Methods Mol Biol. 2016;1451:225–235. doi: 10.1007/978-1-4939-3771-4_15
PCR primers: PCR program:
 Cre forward: CGTACTGACGGTGGGAGAAT  (1) 94°C 2 minutes
 Cre reverse: GTGGCAGATGGCGCGGCAACA  (2) 94°C 30 seconds
 βactin forward: TGATGAGGCTCAGAGCAAGA  (3) 61.5°C 30 seconds
 βactin reverse: CACAATCCACACTTCCATGC  (4) 72°C 30 seconds
Mix these primers together to make a primer mix containing 10 μM of each primer  (2 – 4) X 45
 (5) 72°C 5 minutes
 (6) 4°C hold