Table 2.

Description of primers used in PCR and quantitative PCR

Target gene	Primer name and sequences (5′ ➔ 3′)	Amplicon size (bp)	Thermal program		References
18S rRNA	EuK1A: CTGGTTGATCCTGCCAG 499R: CACCAGACTTGCCCTCYAAT	~500	94 °C × 5 min, 35 cycles of 30 s at 94 °C, 60 s at 55 °C, and 90 s at 72 °C, and a final cycle of 10 min at 72 °C.		[40, 41]
ITS	ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC	~500	95 °C × 15 min, 35 cycles of 30 s at 95 °C, 30 s at 55 °C, and 90 s at 72 °C, and a final cycle of 10 min at 72 °C.		[42]
β-tubulin (qPCR)	BT107F: AACAACTGGGCIAAGGTYACTACAC BT261R: ATGAAGAAGTGGAGICGIGGGAA	~450	Initial denaturation 20 s at 95 °C, followed by 40 cycles of 1 s at 95 °C and 30 s at 60 °C.		[43]
16S rRNA	341F: CCTACGGGAGGCAGCAG R806: GGACTACHVGGGTWTCTAAT	~465	94 °C × 5 min, 35 cycles of 45 s at 94 °C, 45 s at 50 °C, and 60 s at 72 °C, and a final cycle of 10 min at 72 °C.		[44, 45]
cpn60	H279: GAIIIIGCIGGIGAYGGIACIACIAC H280: YKIYKITCICCRAAICCIGGIGCYTT H1612: GAIIIIGCIGGYGACGGYACSACSAC H1613: CGRCGRTCRCCGAAGCCSGGIGCCTT	~578	3 min at 94 °C, 40 cycles of 30 s at 94 °C, followed by a temperature gradient of 1 min at 42 °C, 48 °C, 54 °C, or 60 °C, and 1 min at 72 °C, followed by a final extension of 10 min at 72 °C.		[46]
16S rRNA (qPCR)	341F: CCTACGGGAGGCAGCAG 518R: ATTACCGCGGCTGCTGG	~194	Incubation 2 min at 50 °C. Initial denaturation 20 s at 95 °C, followed by 40 cycles of 1 s at 95 °C and 20 s at 60 °C.		[44]
uidA (qPCR)	784F: GTGTGATATCTACCCGCTTCGC 866R: GAGAACGGTTTGTGGTTAATCAGGA EC807: FAM-TCGGCATCCGGTCAGTGGCAGT-BHQ1	84	Incubation 2 min at 50 °C. Initial denaturation 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C.		[47]
g23 (qPCR)	MZIA1bis: GATATTTGIGGIGTTCAGCCIATGA MZIA6: CGCGGTTGATTTCCAGCATGATTTC	~471	94 °C × 1.5 min, 35 cycles of 45 s at 94 °C, 60 s at 50 °C, and 60 s at 72 °C, and a final cycle of 5 min at 72 °C.	Incubation 2 min at 50 °C. Initial denaturation for 20 s at 95 °C, 40 cycles of 1 s at 95 °C and 30 s at 60 °C.	[20]
RdRp	RdRp1: GGRGAYTACASCIRWTTTGAT RdRp2: MACCCAACKMCKCTTSARRAA	~450	94 °C × 75 s, 40 cycles of 45 s at 94 °C, 45 s at 50 °C, and 60 s at 72 °C, and a final cycle of 5 min at 72 °C.		[26]