Table 1. Bacterial strains plasmids and primers used in this study.
| Strain | Description | Ref |
|---|---|---|
| Novosphingobium subterraneum DSM 12447 | Degrades natural recalcitrant and anthropogenic compounds, AHL-producer | Balkwill et al. (1997) |
| Escherichia coli JM109 | (traD36. pro AB +lac Iq, lacZΔM15) end A1 recA1 hsdR17(rk −, mk+) mcrA supE44 λ- gyrA96 relA1Δ(lac- proAB) | Yanisch-Perron, Vieira & Messing (1985) |
| Agrobacterium tumefaciens NTL4 (pZLR4) | pTiC58-cured derivative of C58, ΔtetRS containing pZLR4 (traR, traG::lacZ), cognate AHL: 3-oxo-C8-HSL | Luo, Clemente & Farrand (2001) |
| Agrobacterium tumefaciens A136 (pCF218)(pMV26) | Ti plasmidless host, Rfr, containing pCF218 (traR) and pMV26 (PtraI::luxCDABE) cognate AHL: 3-oxo-C8-HSL | Sokol et al. (2003) |
| Chromobacterium violaceum CV026 | Indicator strain for detection of alkanoyl-AHLs, derivative of wild-type strain 31532 with mini-Tn5, Kmr, in the cviI gene cognate AHL: C6-HSL | McClean et al. (1997) |
| Plasmid | Feature | Ref |
| pSRKKm | Broad-host-range, KmR IPTG-inducible | Khan et al. (2008) |
| pNsub1 | Broad-host-range, KmR IPTG-inducible containing the novINsub1 gene | This study |
| pNsub2 | Broad-host-range, KmR IPTG-inducible novINsub2 gene | This study |
| pNsub3 | Broad-host-range, KmR IPTG-inducible novINsub3 gene | This study |
| pSB401 | luxR+ PluxI-luxCDABE Tcr p15A ori, cognate AHL: 3-oxxo-C8-HSL | Winson et al. (1998) |
| pSB536 | ahyR+ PluxI-luxCDABE Tcr p15A ori cognate AHL: C4-HSL | Winson et al. (1998) |
| pSB1075 | lasR+ PluxI-luxCDABE Tcr p15A ori cognate AHL: 3-oxo-C12-HSL | Winson et al. (1998) |
| Primer (Target) | Sequence and binding sitea | Ref |
| G9-13F (novINsub1) | JRVC01000013.1 (145,875–145,893 bp) GGAATTCCATATGCTCAACCTCACTGACG | This study |
| G9-13R (novINsub1) | JRVC01000013.1 (146,495–146,517 bp) CCTAGGCTAGCCATGGCTCGATTGTGATGGG | This study |
| G9-11F (novINsub2) | JRVC01000011.1 (118,238–118,261 bp) GGAATTCCATATGATCCATATTGTCAAAGGGTGC | This study |
| G9-11R (novINsub2) | JRVC01000011.1 (118,904–118,928 bp) CCTAGGCTAGCGTTATCGACAATGACATAACCGT | This study |
| G9-28F (novINsub3) | JRVC01000028.1 (28,716–28,735 bp) GGAATTCCATATGTTGAAAGTCACCACGCC | This study |
| G9-28R (NovINsub3) | JRVC01000028.1 (28,037–28,056 bp) CCTAGGCTAGCCGTAGCCATCAGTCTGCAAC | This study |
Notes.
a
Underlined nucleotide bases indicate restriction enzyme sites for cloning.