Table 2.
Putative binding sites for transcription factors in barnase, binase, and balifase promoters.
| Transcription factors | Barnase | Binase | Balifase |
|---|---|---|---|
| AbrB (controls the expression of genes involved in starvation-induced processes) | TAAAAAAT (125–132) |
GAAAAAAG (54–61) | CAAAAATC (119–126 noncoding strand) CATAAACA (219–226 noncoding strand) |
| ComK (is required for the transcription of the late competence genes) | AAAGAACTATTTT (50–62) | AAAGCCTCATTTT (58–70) | Not detected |
| DegU (regulates the degradative enzyme expression, genetic competence, biofilm formation, and capsule biosynthesis) | GAAAAATCCCGGCCGTTTCAG (4–24) | Not detected | ATAGTTCTCGATCGTTTTCCG (7–27) ACAATAATATAATGATTTTTG (106–126) |
| GerE (regulates gene transcription in the terminally differentiated mother-cell compartment during late stages of sporulation) | AAATGGGAGGTA (129–140) | AAATAAATAAAA (25–36 noncoding strand) | AAATAGTTCTCG (5–16) ATATAATGATTT (112–123) |
| Hpr (provides the link between phosphorous and carbon metabolism) | Not detected | GGTGCTATAATATGAGGTA (109–127) | ATGTTTATGTTATAAAGTC (218–236) |
| PucR (regulation of purine utilization) | ATACAATGAAA (95–105) | ATTCGGAGCTG (9–19) | TTTCATGGAAA (91–101) GTCCTCGGCTT (82–92) |
| ResD (regulation of aerobic and anaerobic respiration) | AACTATTTTTAAA (54–66) | TCATTTTAGCAAA (64–76) CTCATTTTAGCAA (63–75) |
AAATTTACAATAA (100–112) |
| SpoIIID (key regulator of transcription during the sporulation process) | Not detected | AGGACAGCAT (141–150) TAGACAAGCA (126–135) |
GGCACATTCT (206–215) GGTACAATTC (139–148) |