Table 2.

Fluorescence labelled oligonucleotide probes used for FISH and CARD-FISH. Abv: abbreviations used in the text and figures.

Probe	Abv	Target	Target Sequence (5′-3′)	(%) FM a	Specificity	Reference
EUB338I	EUB	16S	GCTGCCTCCCGTAGGAGT	0–35	Bacteria domain	[29]
EUB338 II		16S	GCAGCCACCCGTAGGTGT	0–35	Planctomyces	[30]
EUB338III		16S	GCTGCCACCCGTAGGTGT	0–35	Verrumicrobia (and others)	[30]
ALF968	ALF	16S	GGTAAGGTTCTGCGCGTT	20	Alphaproteobacteria	[31]
BET42a b	BET	23S	GCCTTCCCACTTCGTTT	35	Betaproteobacteria	[32]
GAM42a c	GAM	23S	GCCTTCCCACATCGTTT	35	Gammaproteobacteria	[32]
NTR712 d,e	NTR	16S	CGCCTTCGCCACCGGCCTTCC	35	Nitrospirae group	[33]
ACD840	ACD	16S	CGACACTGAAGTGCTAAGC	10	Acidiphilium genus	[34]
TM1G0138	TM	16S	GCAGTTATCCCCCATCAAT	40	Thiomonas group 1	[35]
TM2G0138		16S	GTAGTTATCCCCCATCACA	40	Thiomonas group 2	[35]
THIO1	THIO	16S	GCGCTTTCTGGGGTCTGC	35	Acidithiobacillus spp.	[36]
ARQ915	ARCH	16S	GTGCTCCCCCGCCAATTCCT	20	Archaea domain	[37]
NON338		-	ACTCCTACGGGAGGCAGC	35	Negative control	[29]

^a: Formamide percentage (vol/vol) in the hybridisation buffer; ^b: Used in conjunction with a competitor probe, GAM42a (5′-GCCTTCCCACATCGTTT-3′) [32]; ^c: Used in conjunction with a competitor probe, BET42a (5′-GCCTTCCCACTT CGTTT-3′) [32]; ^d: Used in conjunction with a competitor probe, NTR712c (5′-CGCCTTCGCCACCGGTGTTCC-3′) [33]; ^e: The complete name of this probe in the work of Daims et al. [33] is S-*-tspa-0712-a-A-21.