Table 1. Modification of HCV RNA IRES by alkylating derivatives of complementary oligodeoxyribonucleotides.

DNA derivative	Relative modification extent		Cross-linking site in HCV IRES
		with DNA helper
DNA1-NHCH2RCl	0.1	0.5	C83 (N3)
DNA2-NHCH2RCl	0.2	0.6	A73 (N1)

Sequence of DNA derivative and complementary region in HCV IRES are pTAGACGCTTTCTGCGTGAAGA (61–81) for DNA1-NHCH₂RCl and pTCTGCGTGAAGACAGTAG (55-72) for DNA2-NHCH₂RCl.